Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT023951
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203295
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 223951
Nearest Genes
Gene Nr FlyBase ID Distance
CG9184 FBgn0035208 0 bp
CG9155 FBgn0010246 4177 bp
Sequence Length 2121
ON Targets 0
OFF Targets 0
Viability lethal
Inserted Chromosome 3
Left Primer CCTTCTCCTGGAAACAGAGGCCG
Right Primer TCATTCCGAGCAACCCAATGTTTTC
Template genomic
Sequence CCTTCTCCTG GAAACAGAGG CCGCTGACCA GCAGCTGCAG GATAACTGAA AAGGATGTGT CACTCTTTCT AGGCAGCCGA TCGTCCGTAC TCACCCAAAC CAATCGCAGT CACTCTCCGA TCCATGATCT CTCTCGGAAT AACCTGACCA CTCCAGTTGC ATTGCCCTTT TATACGCGGT GCATCTGTGA TGAGATGTGT GGGATCTCGT TCCCGGTTTC CTCATTAGAA TAACCCATGC AGTGGCCCAA ATTTGGGATG CCTTTCTTTC TTCTGTGTCC ATCTCCATCT CCATCCCCAG CTCCAGCTCC AGCTCGAACT CGATCTCGAT CTCGGATCGA TCAAGCACCG TTCTAATAAC TGCGCTCATT AATTTGCATA TGATATAAAT GCTTGTAGGG GCTTTGTGGG ATCTTTCCAC TTCTCATTCC ACTTCCATGA TCGTTCTGCC AGCCCTGCAT TTTTCCAAAT GAATTCGAAG AGTTCAATAT CCCGCGATAT TGCTGCTTGA TATATGACGA CATTTGAATG CAGATGAAGG TTGGTCATGC CACTGAACAA AAAAATATTC AGCAAAGCTC TTGAGTTGGC AACAAATTTT TTGGAAATAT GTGCCCTTGA ACTTATTGTA TTATCGTTGA GTTTCCGTCT TTAGAACTTA TCTTTACTTT TTACGAATGT ATTTCTCCAT CTCGCTACAA AGCAAATCAG CCTCTGCCTC TTGGTTTCCT ATTCTTAATG CTCGACTATT TCTTTCGGTG TGCGATTAAT GGGTTAGGAA CTTTTTCGTT TGGGTGGGAC TCATGGTTTT TGGGTTCCGT TATAGGTCGT GTGTCGTAGA CATGTTTACG AGTCGTCTGA TACAACAAAA TGTGGAGTTC TCTGTTACAT CACCCGTTGG AGTATTTCTG GATCGGGAAA CCAGTTCCCC ACTCTATTAG ACCGCTGAAT GGGGATTAAA GAAAGAGTGG ATCAAGCCGA CAAAAGCAAC GCCCCCAGGG AACAGAAAGT CAATGACTTC ATAGTAGGGA GAAACCGTGT TATTGCAGGG ATATTGAGCA AAGTATAATT ATAATGACTA CACACTCATT AATATTTACA GTTTAATTCA TTTTATATCC CCCAGCTAGT TTATCTAATC ATGAAAGTAT CTGTAGAGGC TTGCCCCGCC ACCCAGTCAA CTTTGGCAAC TCTCTTATCA TACAACATAT ACTCGTGTCA ATTGGATCCC AAACAGTTCC ATGAGATCTG CACTCACCTG CCCTCCAACT TGTGGATTCC TTAAATAGAC GTAGCATAAT CTTAGGCGAT GGTTGGTTTG TCAAAAGTGC TAAAGTGATT GCAGAATGAC TGCAAATGGC TGTGCCCATT GGGTGATGTA TTCGTATATG GTTTTCGACA TGATCGATAT CCACTTCCAT CTGCCCTACG TGCAATTAAA CAATTATGTG ACAAACATCG AATCACGGCG AGCTCGGCTC CAACGACTGG GACGTGTCTG CCGGTCTCTT CGAGAATTCC TGGGAAGTCT TCCCGGCAAA CATTTCGCAA TTAGTCAGGC ATTCGTTCCA GTTCCACACA GCAAATCCCC TTCCAAGTGG CGCAGAGTGG ATGGAAACAC ACAATAGTGG CGGTGGAGGC AATTGCAATC TAGTGTGTGT ACTTACAATG TTTTCATTCG GCAATGACTT ATTATTTAGC ACACTGATAG CTGATAACAC AGTGCTAATG TGAGCTGGAG CACTTTTCTG AGTCGGGGTT GTGAGTTTCG AGCTCTGACT CACTCAGAAA TGTCCCGAAA GCGCGGCAGT CATCTAGAAA TCTTGAAAGC ATTAAGTTAT AATTTACATT TTGGAGAAGC AAGTTTATGA AATTAGCTAA TTGTGGAGCA AGAACTAAGT AAAGGAATTC CTTATGTACA TTGAAATCAA ATCCTTGATC TTCGCAATAA TGGATACTAA GGACTACATA GAGTAAGCAG TGCTAAGATA AAGAAAGTGA ATAGATTATA AATCATATAG AATAATTCTT GATTAGTTAT CTAAAAACCA AGAAACTGGT TCGCGTAGCT AGGAGGAACC ACATTATGAA TCAACTGAAA ACATTGGGTT GCTCGGAATG A