Vienna Tile Information
VT ID VT032411
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status unverified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203212
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 232411
Nearest Genes
Gene Nr FlyBase ID Distance
CG32183 FBgn0052183 20618 bp
Sequence Length 2104
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CCGCATTTTAATTGGGTTTGAATAAGACA
Right Primer TGTCAGACTAGTGAAGTGGTGGATGTGAG
Template genomic
Sequence CCGCATTTTA ATTGGGTTTG AATAAGACAA CTAGCTTAGT TATGAATGGA TTTACCAAAC ACATAAAATA CTTTTGCACG GCCTACTGAT TACAAGCCAA AATGGATAAA TTTCTTAATT TAAACAATTT TACGTATGTC AGATGCAATA CTTCTTTCAA CAACATTCAA TAAATTCTGT TTCTATGAAT TTTTCGTTGA CCAACCAAAT TGTCTTCGAA ATGAATTAAA CAATCGATTG AACCGCAAAA AGTCAATTAA AATCTTCACA GAAACTCCAG TTGAAAAGTG GTTTCGGGCA ATTTGCCGGC GCACCCGCTC AACGCCTCTC TATAATCCTT GATGAGTCCT GAAGAACTCG GACCGGGCAT CTCAATAAAG CAATCAGTGT GTACCAACTC GCAATATAAA TTTCATTTTC CCTTGCAGGT CACTCGGGGA GGAGACGAGT CCTTGGAGCG GGAGCAGCCA ATGCAACCTG CACAGACATC ATTAGACGTG AATAGCAACC ACACGTGAGT AACTCGGGGC CTTTGCGCCC GCAGACAAAC ACAGACTATA TCGACACTGT ATATCTCGGA CATGTGTCGG CCATCAACTT ATGCAATCAA CGATTTGGCT TTGACCGGGC AAACTGACTG CCTGCCGCTG GGTGCTATGT AAACGGGCCA AAGACGATGG CCCAAGGAGC AGCAGCAGGA CGAAAGGCCC GAGCGAATGT TTATTTAAGC ATAAAGCCAC GTACGCCCTG ACACACACAT GCCCATCCCG ACACTGAGAT TAATACTAAA AAAGGGGGCT TGGAAAATAT AGTATTCTGA TTCTAAAAAC CATAAATTTA TACAGCAGAT GCAGCAATAT GACAGTAGAT ATATTTAAAT AGTTAGGAGA GATTTAACCT TCAATACCAT TATCAGTTTG TTTATTATAA GGGTGTCAAA CAGGTGTGCA ACCAAGAATC TCGGCTATAA TCACCTTTAT CAGAATCAAG CATTTTCAAT ATTTTTCAAA TAATAAGGTT GTGAAAATTG TGCTCTCTGT ACTTCGACTG TCCTTTAGTG TGTTCTTTGG GAGCTATGTA CTTAGGCACA GCTGTACTTG CAGTCCTTGC CTGGTAATTA CATACAGACT ACGGAAAAGG ACTCCTCTCA CTGCAAGTTC CAACCGAAGC CGGACCATTT CCCCTGCTCC TTGGGCGGCT GGATAAATAT TTGGTTTAAC CTTTTTCCTT TTGTGTGGCT ATGTATTTGC ATTTGGTTTT ATGGCAGCGC CTGTGTCACT ATTTCATTTC GATTTGAGCC GAGTTTGCCG CAGTCCTTAG CCAGATTTGT ATCCTTAATT TATTTGTTTG CGATTTTCTG ATATTTTGTA ATTGAGTTTT TCCTTTTTTT ATGCTGATGA GGGTTTAGCC AAAACGCCAT AAAAGATGTC AAGAAATAGG GGAAGCAAAC TGTTGATATT CATTGGACAG GACACGTTCA CAGGCAGGAT ATTTATATCA GGACGTGAAT GTGAACGAAA ATATGTCCCC TGGGAGGCTG GGAGGAAGTA CTCAGCATCC TTAGTAGTCT TAATTTATCA CTATGAATGA ATCACTTGGC CTCAGACTTC GTTTCTTGAA AGGACACGTA CCTTTGGCGA CAGGATATAC TTTTGACTTA ATTGGATTTC GCCAGAATGA ATTTCAATTA GCTGCAAATG AAATTTCGGG TCGTTAAGTG ATTCGCAATG AGATAAAAGG GTTTCTAACT AGCTCAAACG GATGATGTCT TAAATTAAAG GCAAATTTCT CTTTCTTCTT TGGCCCCAGA TGGATTGTGA TTTGTATCTT AGTAGTTTTA CACACCCTCC ACTCCTCCAC TTTTCCTGCC GTAAGCCTTT GTTAAGCACC AACACTTAAC TGTGTCACGC TCGGATTTAT GGCTCCATGA GGATCCTTTG CATCCTTCAG ATACCTTCTC CATATCCTCC AGCTTCTGGC TCTGCACTCC ACGAGCTGTT AGTTTTCCCG TTCGGGCCCA GAGTTGATTG ATTTCTGTTC TAGTCGGGCC AAAGAGCATT CTCTAAGCCC ACCCACTCAC ATCCACCACT TCACTAGTCT GACA