Vienna Tile Information
VT ID VT026396
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203207
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 226396
Nearest Genes
Gene Nr FlyBase ID Distance
CG7018 FBgn0005658 20079 bp
Sequence Length 2121
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CGTCGAATGCGTAGCAAATTCAGCA
Right Primer TGTGGGTGCATTGGGTGTCTTTTGT
Template genomic
Sequence CGTCGAATGC GTAGCAAATT CAGCACACAA TATACAATCA TAATTCTATA AATGTTTTAG CACGCACAAT AAGAAATGTG GAAAGTTGAG GGAGTTGAAA GCTACGACAA AAAGTCAAAG TTCAAATGGC GGAATACATA AGCCGGGAGT CACATTTCAA GGAAGCAATA ACAAAAAAAG GTTAAACCAC TAGTTTTTGA GGCAAAAACA CTGTTCAAAC TCTTATGAGT TTTTAAACTT ACTCTTCTTT AAATGCAGTT TCAAAACCCT TTTTAGAACT ACTTCTTCTC TTGAGCCAAT TTAAATTCAC AGCATGGCTC CTTCCAGTGA AAGTGCTAGC CATAATATCT CTTTGGCTTC CCGGAGGAGC TGCTCCATGC CACTTCCATT ACACTTACAT GCAATGCCAT TTCCGCTGCG CTACACTTCT CTTACAATAA TTTGAGGCAA GCGTCATAGA TTACCCCCGT GGTCTCAGTT ATTTATTGGG AGTGGGGAGA GCCACTTTGG GGGGTTCTTG GATTGCGTTT CGGTTCCCTA GCCAGCGAAC TGGGCAGGAA ATGCTTTATG GGTCCTTTGC ATGCCCCAAA ATGCTTACTA TTTTGGCCAC ATCCCCGCAG CCGTAGTTAA TTTAGGCCCC AAAACGCCAA AAGGATATGC TCTTTTGATG GACATTTAGG CAGGCCCCAA AAATACCCAC ATTAAATGTC TCAATACTTA CGAATCACTG GGCTCATTTC TCAAATTCCC CCATTCCAGG CTCTGGCCAA ATCCAGCTGT GGCAGTTCCT TCTCGAGCTG CTCTCGGACT CCAATAACGC CAGCTGCATC ACCTGGGAGG GCACCAACGG CGAGTTTAAG CTAACCGATC CCGACGAGGT CGCCCGCCGC TGGGGCGAGA GGAAGTCCAA GCCCAACATG AACTACGATA AGCTCAGTCG CGCCTTGAGG TGAGTTCTGA ATAACATTTT ATTTATTTCA AAATTTAATT TAATATATAT TTAATTATAT ATATAATATA TAGTATTAAT GTATATTCGG TTGTATATAG AACTTAGCTG TATAAAATAC TCTTGAACTA ATGCCAATGG AATACTATGT TACTTCCATT TAGTGTATTA GTAAACTTTT TCTTCAACCA ACCATTATTG TTTCGTATTT AAGATATCGT GTGTAGGAAA AATAAAACGA GAAATCAAGA AACGTTTTTA TATTGAGCAT AATTTCACAT AGAAAAAAGT TCGATTTCGG ATTACTTTCA TCCCAGTCAT GGGGATGTTT TCCTTGTGCA CTGGAGTATT CCCTAATTAG GCAGTATCTG TGCCGTCGTC GAAATGCGAG CATGTGTGCA ATTTGCTATT TGGCTCATCA GTAAATGATT TGTCCCTGCA CTGATTAGCC GCTTTGATGG CTAAAGAGCT AGAAAATCAC CCAAAAAAAC TAGCTAATCC ACTTGCTGAC CAAGTCTTTG GCTCACTTGA TTGTGTGGGC GTGGGCAGGT CGACACAGAA ACTCAATCAT AAATTGTTCG TCAGGACCGA AATGGAATGT AATCAAAAAT CCAATAAATT CGCAATCTAA TTGCAGAGAA ACGTAATTCG ATTTCGAAAT CTGGAACTCC AATATTTGAC GAAACACAAA CCATATGCAC AAACTATTTG TGCAACGGTC AATTGCCTGA ATAAACATGG CCAGGACATG GAGAGTTAGC CTTATCCTGA ATGGCGAACC CTTTTAGCCG GCTCCTTGAA ACTGTCACTC GCAATCAGGC GAGTGCCAAT GATGCGAATT CAAGTGGAAA AGTCCTGACA GCCAATTTGC AACATGCTCC GCACACACAT GTAAATAAAA TGTAAAAAGT GTAGAAAAAT CACGCAACAA CAATGGCAGG ACGACGGTTG GGGGCGGTGT AGGAATCCTT TTTGATGTGC AGGAAGCCTC AACATGTCTG TTCTTTTTGC GCATTTCAAC TCAATTGAAC ACAAGAGACA TCATCGCCGT TGGCTTTCAT GTTTGCTCAG AAATGCGAGT GTGTGTGGGT GTGTAAATTA ACACTCAGCT CGGGTATCCT TCGCACTCAC ACACACACAC ATACCCACAA AAGACACCCA ATGCACCCAC A