Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT009677
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203179
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 209677
Nearest Genes
Gene Nr FlyBase ID Distance
CG10619 FBgn0003896 12310 bp
CG18397 FBgn0032723 48254 bp
Sequence Length 2131
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CCCATTTCAATGAACTTTTCGACAACGA
Right Primer GCCAGGACCAACCCCTACCACTTAC
Template genomic
Sequence CCCATTTCAA TGAACTTTTC GACAACGATG TTTCTCTACA TACACGCAGC CATTTCATTA TGAATCACCG AGAAAATCCT CAGAACAAGT TCGCCAAACG ATCTCAGACA CTTTCCCTGC TAAAGAAACT TTTCACACAC ATCGCACGGG GAAAGCCCTT AGGAAGCTAA GCATTAGAAC TGCCATTAAA GTGTCTTAAC TTTTCAGGGG TTCGTTTTGT TTCAGTTCAC GTTTGTGCCT TACTGATTTC CTCTCTGCCT GGTTTTTCCT GCGCATTTTT TCCACATTCC CATTTCAAGT CATTCGCAGC CATTTCGAGC CTTCGTACTT GCCGTACTCC GGAATGGAGT ACTTGGAATG GAACTCCACT CGAACTAAAC TCTGGCAGTT ACAGGGACTT TCCTTTGGGT TGGGCTCTGG TATTTCAGCT CTGGGGTTAG TAAATTTATG ATCCTAGTCG TTGAAATGAC GATGAACTTT TTGCTGCACA CACGAACTTG GACTTGGGTC GCCGGTTTTT GGTTGTTGCC CGGTTTTTAT GCACCCCGAG TATCATCTGC TTAATCACCA AAAATAGCCA CCATATGGCA CTCGCCCACA GAAAGGGAAA CACGACTTCA AAGGAGTCTC TGCTTTTTGC ACGCACTGTG TCGGTGTGTT TGTGTTTAAG TGTGTGTGTG AGCCTCAATA ATTTATTCAT ATGCGCTTAC AAGTCACTGA TGTTGTTGCT CTGCTCCTTC GACGCTTGCC GCAGACAATT TATGCACGCT TTTGCGGAAA AGCCGCAGGA AAATACACAG TTTTTCCGTA CTTCCAATTC GTAGTTTTTC TTACGCCGTC GAGTGGTATT TTCAATTCTA CTAGAAGTTT CTAAGGCGTA GCTTTTCAAG GGAGAAGTTT TTGAACCCTT TGTGCAAAAT GCTCAAACCA TAAAAACTAC CTCATTTCCT TGCAATTTAA CTTACATTTT AAGTTTCATT TTGTATTTAA GCAACCACTG AAAGTATTTA ATGTTACACC AAATACCCAT CAGTTTGATT TTTGAGCGGT AGCTTTGGCC CTTCTCAGTT TGAAGGAGAA ATGCGTCGGG CTAAGCTGCT TACAGTGAGC TGTCGATAAG AGTGCGAGAC TGACTGCCAG CAGCGATCGC TCATGTACGC CATAAATCAT AAAGACGCGA CCTCGGATCG GTGTCCCCAG CCATACACTC GCACATATAT CCAACTCCAT GGACACCGAT CTCGTCTCCG ATTCCCATTC CGATTCTGCC GCCGTCGCTG GCCTCTAATG TGCTTAAGGA ACGCTTAAGG TTGTCCGCAC GTCAGGAATT CGCGTCCCGA ACTGATAAGA GACGAGTCGT CGCTGCCCTA CCTGGATTCC GGCCTGAATT TGAGTTCCAG ACTCCAGACT GCGGCCCAGA ACGACCATGC AATACCAGAA GCCCGAAATC AATTGCGTAT TTATTGGTCA CAATCAATGC GGCGCGACAA GCAATGGTAT ACGCAAGGAG AGGGGGTAAG AGATGATGCA CTGAGGGAAA AAAGAAGTAT GAAGATGCAC ACTATTACAT AACAAAATCG TAGGTACGAA ATCATAAAGG TAATTATTTT TATGTCTCTA TTTCATCTAT AAAATATTTA CATATTAACA ATATATACTA TTTCCATGTT CACAAACATT AGATGATTTA TGGGATCAAT TTACTACCCA GCCCATCATT CGTGGGCTTA AGTGCCTGGA CTATTTTTCA CCGTGTAAGG AAAGAGAGCA ACTGACCGTG GAACGATCGC TTAATGATCG CCCACCGCGT CGCCGTCAAC GTCAACCGCA ATAAGCCGGC GGCGTCAGCA GAGAAGCGCA CCCACTTCAT TACCTCTCCT GGAGAGGATT GCCTGTCCAG CGGTCGCATC TTCTTCTTCG TTTGGCTTCT CGGTTGCGTC ATGGCTGTGG AATGCCAGCC CCTATAATGG TGTACCTCCT GGCCGATTCC CTACCTGACC TGTTGTCCGC GTGTCTCTCC AGGCGTAATC AGTTATAAAT CACCCGTCTA GGAAGTGCCT GTGTTTCCTG TTCCCAGTTT ATGGTCCTGC CAAAATCCGA GGAAGGGTAA GTGGTAGGGG TTGGTCCTGG C