Vienna Tile Information
VT ID VT008825
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203176
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 208825
Nearest Genes
Gene Nr FlyBase ID Distance
CG15138 FBgn0032629 1759 bp
Sequence Length 2210
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TCAAGTGCTTAAAGTCTAAAAGTGAGAATCAATGG
Right Primer GACGCCGGGCAGACATTCAATAAAG
Template genomic
Sequence TCAAGTGCTT AAAGTCTAAA AGTGAGAATC AATGGAAATT AATGAAAATT TGCAAAATTC AGATAAAAGC TTTTGAAAAT CAACCTAACT TTCTTGTTTT ATTTAGAATA CGTAAAAAAT CATAAGTCAT TTTCAATCAA TTCCGGACCG CCCACTTTAT GCATACATTT TTCATTACAT TTCAGAGTTG TATATTTTTA ATAAATTCTA TAACCGATTT CCATGGAGAG TAGAGGGCTC AAATTAATTG TGAGACATTC GAGAGCAGGA GTCAATTTCC AAACAAATTT TACCGAAGAA GCCAAAACAA TGATTTTATT TAACTTGGGC CCTGGCCATC TCAATTGGGA ATATGCCATA AATTTACAGA AAAATGGAAA ACAGGACAGG AAAAATACGA TTTAACTGTG AAAAATTTAT ATTTGTGTGT GTCTTCACTT TTTGGCCCGT AGCACAGTCG TCATCATCAT CGCCTTGGCC ATCATTTATT CATGACAATT TTGCTTCTCT CAGCTGCATC CTAGAAATAC GTAGTGAAAA CGGAGTCACA ACTATGCCGG TTGCTTTTAG GTGAATTTTC CTGCAAATGA AAAACCCACT CATCGATAAT GCAGACGAAA AACCGCAGCG AAACAGGGGT TGAGGAAATG TAAAGCAATT TTCATCCCAT AACTGAGTAA GGAATATGCC TTTATTTTTT GGCCAGACAA GCACAGTTGG AGTTTGGTTT TTGGGGCAGA GATTCCCATT CTGAAGCCCA AAAAAAGCGT ATTTTCCATA ACTTCAGCTA GTTGACAGGG GGAAGCCCAA AATTTAAACT GTGCAAATGA GTTGGCCACA AAATGTCAGT TACAGACACC TCACCAAACT TTTTTCCCCT TTTACGAACC GCAAACGCGA CGAAATTTTT GGGGGAAGAA AACGCATAGA AGGAGTTGGT TAACGTTTTC TTTTCCCCCC ATCGTGCAAA TAAAATCAAT CAATTTTCGG TCTGGCAAGT GGCAGTAGCA ACCAGTGGAA GCAGCGGCAA AGCAGTTTTC TAAGTGCTCT TCCGACACCG AAATCTATTT GCCAAGGTGA TGACAAAAAG TGTGGAGACA GGGAGTGGAA AATGGGAAAA GTATTGCTGA TGGCGACGAC TGGTTATATG TTCTTTAGGA GATCCGTAGA AAAGCAGGAT GCGCTCAAAT TATTAGTTAA ATAGTGCTAA AGGTGATTGT TGAACAATTG GGAACAACCA AAAATTTGGC TATCGGTTTA CACCACTTTA TTAATCCTTT TGTAAATTAA CTAAAACATT TCAAAATATT TTTCTTTAAG TTACTTGAAT ACTTTGTATT TACTGAAATA CAACATTACT ATGATCTTTA TATGTGCTTA CGTATTTGGT TCATTAACTA GAATATACTT TTCTGTGCTC ACATCGATAA TTTACTGTAT TCAAACTGTT CCCATTGAGA CGATACTCCT TAATAAGTCA TCGATTTCCA TGGCAGTCGA TACAGACCCA CTTTCGAGTA CGGTTCCGTA ATTAATAGAA TCAACTGGAG AGCAAACCCT CAAGTGTTGA ATGATTTAGC AGGCCCTTCC CCCGCCTCTA TCTGATTTCA CCAGCGGAAA GCGGCGTTGA ATTTTCATTA ACAAAAACCG CAATGGGAAT GGGAACACAG AGTTTTCGAG CCCTGTGTCG ATTTCTGTGT AATGCCCGAA AATAAAAATC AATCAACACG TTCGCTTAAT AGACCATCGA CTCTGTGCTC AGATGTAAAT GTATCTGCAA GATACATCTT CGAGTATAAG TATTGCACAA AGACAAATTG CTTTTGTCTC TAATTTTAAC ACGACTTTGA CGGGCTCTTC TTCTCTCAAC TTTGCCTTAA TTTGTTTGCC GTGGGAGTGG AAAAATGTTC ACACGGTTAA GATTTTTTTT TTTGTCTTTA ATTTTGTCTA TGTTTTGCTT GAGTTCGGTC TGGAATTGAT TGGCGCACGT TTTGCGCGTG GCTAAGCAAA AAAGGGAAAA CATAAATAAA TACAAAGGAA AACTTTACTC AATAAGCAAA AAACCAGCGA GAGTACAAGT ACACAAATTT TTTATGGGGG CTCCTCACGA AAAATGCATT TCGAAAAATT TCACATTTAC ATTTGGGGTT TTTCACCGCT CTGCTTTATC TTCTTCGGGT TCAATCTTTA TTGAATGTCT GCCCGGCGTC