Vienna Tile Information
VT ID VT019729
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203148
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 219729
Nearest Genes
Gene Nr FlyBase ID Distance
CG12484 FBgn0086604 19560 bp
CG11192 FBgn0034507 47487 bp
Sequence Length 2238
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CAGCGTGGCAACAAAACTGTGGTCT
Right Primer CGAAATGGAGTTGGAATGAGAAGGCA
Template genomic
Sequence CAGCGTGGCA ACAAAACTGT GGTCTCCGGC TAAGCTTGAA TCAGATGCAA AGCCGGGCCA ATATGACATT TCAATTTTCA TCAACAACGG GCCAGCGCAG CAGCAGCATA AGCACGATGG GCGGCGACGA GGGGAAGACA CCTGCAACAG CCAACGGGAA ACAGACAATG ACAACGACGC ACTTCTAATA CAATACAAAC GCAATAATAT CGGATTTCCG TTTCCGCATC CGTTACGCAG CTGAGTTTAC AGTTGCCAGC TTCCAGTTGC GTGTCCTGGC TGGGGAAAAT CCAAGGGATT TTTCAGCGTC CTCCGACCAC TCCGACCATT CGATACAATT TGTTATTGGG TAGCTGGAAG CTGGTAGCAA TGGAAAAACA ATTTAGAGTT CCTCGCTTTC TGGCTTGGCA CTTTTAAGCA CGCCGAAGCA ATAAAAACTT GTTGGGTACT CGCACGAACG TATGAAATAG TGTGAAAGGA TTTCATGAAG TTGCCATGCA ACACGGGCGC ACAGAGCCCG GAAAAGTCAG TGTGTGTGTG TGTGTGTGTG TGCGGAAAAT GGTGAAGCGG GGAAAGTTGG GGAAAATCGG GGGCTCGACA CACCGTCTTG CAATTGAATG CGTGTTGACA ATGACGACAA TCTGCACAAA GTTCAGGCGA CAGCAAAGCT GGTAGCAGGA TATTTGCAGG GCACAGCGCA ATAAATCGCG CCTTGATGTC TAACCTGAGG CAATAATGGA TATTGATTGG AAAGTTTGAT TGATTTTCTT CGCTTCCCCA CGGAGAGTGC AACGAAACTT GCCATCGATT TCAATGTTAA CTGTTAAATC TCTGCTTATG GCTGTTGACC GAAATTTATA CCGCGGCTGG CAACTAATAA TGAACCAAAA CGTACTGCAA ACCCATTCAA TTACAAATAA CCGTGATAGT AACAACGACG AGTGTCCTGA AACCAAAATC AAACCAAAAC CGAATGAGTG GCCCAAAAGG CCGCAATATA CAAAATGTTT TTTTAAACGT TTTGCATGGC GACCATTTGT GTGCGAGCTG GTGTGTGTTT GTTTGGCTGG CATGGAGGAT TTATATAACA AAATATTCGT GTGTGTGTGC TGTGCGGATT GGAACGGAGC GGAAAACAAG AGATTTAATT TCATTTGGGT TTTAAAATGG CAACGATTTC CATATGCCGC AATTGTGCAC TGTGTGTATT TGTCTTTTTT TTTTTGGGCA GGTCTTGGGA AACGATAGTC GTCGATGGCA ACGTGGCGTA TGCGTGATGT GGCTGGGGGG TGAAAAACTT TTACTTTTGT CATTGGTTTA CGGCCTACTT TTAGGCGCCC GAATGAACTT TATGATCAGT TAGTTTAGTT TTATTGTTAA TAAATTTTGT TTATTTTCAA TGAACAATCC CAAAGCCAAG CACATAAAAT ATTTTTTTTG GCGAAAACAA CAATAGGAAC TGTCTCAGCG AACTTTTTGC CACCCGATTT TTATGGCATT AATTTGTTTA ATGTACAACT TTAGCCAGCC GAAACTGTTT TAATATTCAA ATAGAATAAA TGGTACGGCG TAGCTGAGGA AATTGGAATG GCACTCAACT TTTGCCCTAT CAGTTGCTCA ATTTCAAAAG CGGCCACACA CACACACGCA CACACTTGCT GGATAAAACA GACATTTCCC CAGAAGATTT GCTCGGTTTC CATGCGTTAA ATCAGCATAT AATCCCAAAG TATTTCCAAT TTTATACTAC CCCACACACG CGCTTGCGTG TGCACCCCAA GTCATGTCAA ACAAACTTAA AAACACACAA AGAAAGGCAC TCAATGGCGC CCCCACCCTT AGAAAACACA TACAGATATG CTGACAATTT GCAAGTTCTT TAAGGTATGC GCCAAACTTG AAGCCACTCC CCCTGGTACC CTTGAAGCCT CCGAAAACCC TAGATCCCTG AAAACCCTCG CTTTTTCTTC GGGGGCGTAG AGCTCGAGTT GAAAGGCAAC TAAGGCGCTC ACATTCGCTT TCGAATCCGG GTATCTTGGT ATCTTGCGTA TCTGCTTATG CCTCGTCAAT CTAAGCCCCC GAATCTTGTC GCTGTCATGT TGTATAAATT AAATGTGTTT ATATTAAATG TAGGAGTACA AAAAATAAAA ACAAAAACCC GAGATGGAGA CAGATTTTTT GATATCAAAA CAAAAAAAAA AGAAATATCA GTTGCCTTCT CATTCCAACT CCATTTCG