Vienna Tile Information
VT ID VT017255
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203147
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 217255
Nearest Genes
Gene Nr FlyBase ID Distance
CG8204 FBgn0034033 44291 bp
Sequence Length 2142
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GGGCAATTGTTTTCATGCTGCACTCT
Right Primer ACGAAATATGCTCGGCCACGCTC
Template genomic
Sequence GGGCAATTGT TTTCATGCTG CACTCTATAT ATTTCGCAGC CTTTGGAGTG CAATTTGTGT CGGTAGGAGG CTTTGATTGC AATTTCAGTT TGTAGCCCGA AAAGCCCTAA TTGACATCGG AGGCCGGGGA GCTCAAAGTG AGGTCCTGGG GAATTGCGAA TCCATTACTA GTCCGAGCAC AGCTCTGGCT CGAGCTCTCT TGTCTTGTCA AGTTTATGGC TTGGCCAAGC GGTCAGCATC TCAATTGGCC GAGAGATGCT CTTTCCAATT CCCGAATTCC CATACCGATA GTGAGCATTT GCCAAGCCAA AGATGATGCC GGGCCCATAA ACAAAGAGTT TGAAATGTTT AGCACGAATA AACGGCGGCT ATTTTCATTC GCATTACGTC AACAAACGCA GATGTTCCGA TTTTAGCGGC CGGCACATAC TATACATATG TATGTTGGTG GAGATAGATC CACATGTTTG CCGTTTCGCA AAGCGGCCAA TACATAAAAG TTGCCATAAA CAAACAAAGA TTTCGCAACC AGCAACGGGG AGAGAGATTT GCGAGAGCAT CTAACCGATT TGTAAACAGA GATCGAGGCG GAACTGCAAA TAGCTAGGTG ATATAGGAAA ATCGTGGTCA GATTTCGTTA GAATCAGCAA CCAGCAGCTT TAAACGCACT AAGATAAATG GGTAACACCA TATCAATAAC TAAATCAACA AAGTATCGGA GTATTGTACT GTTTCTAGTT ACTAATTACA GTTCTTAGCT ACTATTTATA CGTTCAACAT CCATATTGCT GCCACATAAA ACAAAAAAAC AGAAATATAT AACAGCAAGA AGCCACTCTA GACACACAAT TTATCCAAAA TTCTGTTATT ATCAGTGTCA CACTTGAGGC AAAAAGCAAA AATCAATCTA GAGCCTGAAG CAACTAGCAA CATCCTGACT TCGGCAGCAA AAAGCAAACA TCAATCTAGA GCTAGTGGCA ACTAGCAACA CTGTGACATG GCAGACAATA GAAGCAACAA TCAGTAGCAG CGGCAAGTGC TGTGAGCAAC AACAAGCAAC ATCCTACACA GTGGTAGCAG CCACATAAGA CCGGTGGCAG CCATCAGGAA CACCAATCAA CTCTGTCATC GGGGGCGTTG CTTTAATATG CAGCCGGTTG TCAAAAAGAT TATGGCACAT AACGACAACA CCTGTCGCTG CCTGCTGATG CTGCTGCTGC CGCTGCTGAT GTTGGCGATG GCGATGTTGC TGGTGTTGCT TCGACTGATA ACACACGGAG ATAATGACGC TCAACAATCT GTTGCTCGGC TGATGGCCTG GAGCTGCTGC TGTTGCTGCT GGTGCTTCCT TTCGACTGTC TCGCATTTAA TGTGGCCACA TAAATTTTGG GGCAAATCAA AAACGCGTTT TATGGCTTGC CATCGCCGAT GCTGCTGCCA CTGCTGCTGT GTCCTGACTT GGTCCGAGGG CTAACAAAAT TTATTGCATT TTACAAGCAT ATTACAAACG CTCAGCCCGC ACGTACAGAG CTTTACCCGC TCTCCCCCCC CCCTGTTTTC CCTCTGCCCT TTGTTCCGAC TCTTCAATTC CCAGCAGCCA CATAAAGCGC GTCATGTCCG TTGCTTGTCC GTGAGCTGTC CGTCCGTGTG TCCTTAATGT CCGTATTGTC CGCTCCTCTG CTGCTCTGCT CCCCGACTGC TGAGCCCCTC GATTCTTCGT GGCTGCCAAA TTGATGCAGA CTCAGTGGCG CCAGGAGCGG CAGCAGATTC AGCTTTTGAC CATGGTTATG GAGCAGGAGA AGTGGAATTG GAATGGGAGA GCAGTCAAGA TTGATGGCCC GTTGAATTGC TCGCTCTGCG GCTATTCCCT CGACTTCTTC AGAGCCCGTT TCTCGGGCTT CTGTCTCACC ATATGAATTA CTCATTGCTC ATTTTTGCTG CAATTTATTG TCATTGTTGG TGGCGCGGCT GCCACTGCTG CTGCTGCTGC TGCTGCTGCT GCTGCAGTTC TGATGCCGCT ATCGCAATTG CAATTTTTCT TGCACATTCT TTATGGCAAG ATGTTTTTCT CGCTAGATTT TTCATGTCGT CGCGGGTCTC TTTTTCTCGC CGAGTGAGCG AGCGTGGCCG AGCATATTTC GT