Vienna Tile Information
VT ID VT016116
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203144
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 216116
Nearest Genes
Gene Nr FlyBase ID Distance
CG17048 FBgn0033828 19599 bp
Sequence Length 2184
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CATCTCGCACACGGCTTTCCTTTAC
Right Primer GAGCCACTGCCCATCCATCACTTTT
Template genomic
Sequence CATCTCGCAC ACGGCTTTCC TTTACGGATA TTTTCAGGCG GACAGTTGAT GGTGTGCGGT GTGTGTGGGT ATGCAAATGC GTTCGCATTT CAAATGAATG TGGCATGCAA ATACCGAGCC GTGCACAAAA TCGTTCCAAA TGGTTCGAAA TGTGGAAATC AAAACAATCA AGTGAAGCGT TTAGCCCCGG CCGCACCAAC TACATACAAT GGATGAATGA GATGGCAGCA CTCGGCGAGA AAGAGACGAC GCGATGCGAG ACAAATGTCA TAAATATAAA ATCAAATGCA AATTGGAAAT GCAGACATAG AGGCCGCTCT ATGCAGCAGC AGCGGCAGGA GCAGCATACA GATGCAGATA CATATCGAGA TTTAGATACA TTTTAGCTCA ACTGAATTGG AAAGGATTTG CGAAACATTC AAATTGCGGC AGAGCGAGAG CGCAGCTGTG GCAGAATGAG ACAGCGCGAC ATGGCCAGAA TATTTGCATT TAATTAGCAA AAAGCCCGGC ACATCCAATT GCCGGTGGAT GGGCATGAAA TTTGTTTATG GACAACTATT AACATTTTCC AATTACACAA CATAACGCTC ATAAATTATG CCATGCATGT GTAATTGTTT CGAGCCCCTT TTCCCTCCTC TCACCCCGCT CTGCCCCATC ATTCCTTGCA TTTGTTTGTT GTTTAATTAA GTATAACTTT GCCGTGGACA AATATTCAAT AAGCAGGCCA CAAAACCAAA TCAACGGAAG TTGTTGTTGC CGTTACAGTT GCAACATTCG AGTAATTAAC ATTAAATCAT AAATGCCACA AAACGCTACG GAAACGAGCA ATATAGCCGA TTCACTTTGA TTATGATTGT CATACGGATA GACACATAAA TCCGAACGCG AATTGCAATC CAAACTGAAA ACTGCGGATC GTATTTATTC TGGCAACTTT GTCTCGGCCC TTTCAGTTTA TTATTTCCAG CAGTCAGCAC ACACAAAGTG CTGAGCTCTG GAATGTGTGA ACGAACGGGC ATCGCATTTC TGCCATTTTG GGTTCCTTGA ATTGAGATTA AACGCCAATT CCCAAGATCT TAAGTCACAG CTCGGGGATA GTTTTTGTGA GCATGCGATA AGAGTAGTGC CGGATAGGGG GACTCTATAT ACACATGTAC ATGCATATAC ATATGCAAAT ATTGAGCTGG CATTTCGAGG GCAGGCGATA AAAGTCGAGC TGCAATGGCT GCAAAGATAA CCATGTGGCT CGGTGACATC AATTGAAGGC CATTGTTTGG CTCGCAACCG AAGTGAACCA AACCAATCCT AACTGAACCG AGCCGAACCG ACTGCATAAT TGATGCCGCG CTCAGCCAGC TCATTTGCCT ACCAAATGCC TTCGAGAAAA TGCCAATCAA TTGGAAATGT TTTCAGCCCG ACATGTATGT ATGTAGTTAT ACTTATTCAC CATTAACCCC CATCCCTATG CTCTTCTTCT GGATCAAGAC GCTAATTAAT CATTGCGATG TTTGAGGGCT GGGGCAGCAA AGTCAATTTA ATTGATGGCA GGATGAAACC GGAGCCACCA CCAAAACATC CGGCAGGACG AACCGCAGAC CCAGTTACAT TTGTGATCCT TCGAGCTGGG GTTTCCCAAG GATGCAGAGG CTCGTGTGAT TTGCATGGCT AATTTGACAG ATTACATGGA AGACATTGTG TCCCGTCTAG ATATCCAACC ACACACGCAT GACCAAACCG AATGTGATTA ATTGCATTTA ATGATGCGAC AAGCAAATGA AGAAATCAGT AAAGGAATCG TTGTTTAATT CAAATGTGTT GAATCTAAAA ATCTTAGGAA TGTAGAGTGA ACTCCCAACA AAATTCTGTT TAATCACATT TAAACATTTA TAGAAGAAAT ATTTGTTCAA TCAAAATAGG AACTGTGATA AAATTCTAGC CTATGAAAAA TTACTCTAGC TTGAAAAATT CTTCAGCTTT GAATTGGATT CGAAATGGAT GCTGATGTGC AAACTAGTTT TAATAGCTTG TAATGATTTT AGTTCGTTTT CTTATAGATT CCCATCTTTA GTTTGCCTAA TATTTTTAGC TTCAAACCGT CTTTAATCAA AAGTTTAGTT TATGTTTTCG GTTTCCTTTC TCATATGAGT TTGCGTTGTA AAAGTGATGG ATGGGCAGTG GCTC