Vienna Tile Information
VT ID VT020614
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203126
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 220614
Nearest Genes
Gene Nr FlyBase ID Distance
CG34370 FBgn0085399 28 bp
Sequence Length 2195
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TGGGGAATTCCTAATGGAACCTTGG
Right Primer GGTCGTGTCGTCGTGGTGGCTT
Template genomic
Sequence TGGGGAATTC CTAATGGAAC CTTGGTTTTT TGTTTGTGTG TATGGCGACA CCTACCTCGT TTCTGTGGCG CCTGCATGGA GGATGGCGAT GGCGTCGCCA GGCGCTCACC CACCAGCTGG AGGAGCAGCA GGAGCATCAA CAGGCCACAG TTGAGTGCTC GTGATCCGGC GGCAGCTCCT TTGTTCCGCC CCATCGTTGG ACGACGGGTG ACTCCACTGG ATCCTTGACT TTGGTTTTTG TTTCGGTTTT GGTTTCGGTA TTGATTCCAC ATTTCGCTGG AGCGTTTGCT TTGGTGCATT TTGGTTTGTG CACTTCACTT TCACAACTAC CGTTTATATA TTTCTCTGCG CCTATTTATT TTATTCGCTC ATTGCATATT CTACTGAAAA ATAATTTGAA TTCGAAGAAA AAACAACTAT TGTGAAATAT TCGTCAAATA TTTGCAATGC TATTTTATTT GATAATTGCA AATGCATTTT CTTGTATCCC TCCTATTTTT ATACGCATTT AGCCGGGCAT ATTTGCTATT CATTAAAATG CAATTTACTC TTTAATTGAT TTTTTGTTCA TGGTTAACAT TTTTTTTTTT TTGCCATCTT TTAATGGCTC ATTGTTTGGT CATCATTAGT CATGGGAAAT CCAGCGGGAA CTGAAAAACG AGTAAAATCC CGTGAGGCGA ACTGTTGGCA ATCATTCTTC ATTAGAAGAG GCCAGCATGT CAAGGACTTT TCGAGGACGA CCGCAGAAAT ATCGCAGCTT TCTTCTCAGC TGCTGTTTTC TATTTTCTTT TCCATTTTTT GGCTGATAAA TATCAAAAAT TCACAGTTGC ATTTCCATGG AAATTGGCAA CGCCAAAAAA GGAATGGAAA GCAAAAATAC TTTTTTTCTG GCAGCCAACT AAGGGCTGGC GACGCTCTGT GGAGCTTGAA AAATTGCAGC AATTAGTGGT GCCTGGAGGT CAACCAACCA TCGAGCCAAA AAGGGCACGG ATCCACACCA ACACCAACAC AGCCCGGATC AGGATCCGGT GCTGCAACCT GGCGACGTGA GTCAGCCAAG AAAAATGTGG CTGAAATATT TTGGTTACGT TTTTTTCGGT TGTTTTGGTA TGAAATACTT TTAAAGGGGA TTTTTTGGGC AGATTGAAAA AATGCTTGTT GTAAACGTTG ACATCGTTTT GTAATCTAGA GAATAGCTGG ATATTACAAG GGATTTTTAA TAGCCATAGT TACGCAATTC CCGTTCACGA TTGCCATCAT CTGTCCTGTT ATTATTTATG ACATTATTTT TACTTATTAA GTTTTAAGGA TGCAAATAAT TCGCAGCTTT GTTTATTCAA CGCAACAAAT GAATATTTCA CGAATATGTG CATTTTTTTG TTTAATTGTT TGATACACGC ATTCCGTTGC GACTCATTCG GTTTCATATT TCATTAAAAA TATAATACCC TTCCACCGTT ATTTCAATGA TGAATGCCTG CTTGGCCAAT TCAAAGGTAT CGTGGCGGGT CGTTTTGTGG GTTCAGCTGG TTCAATATTT CAATGGGTCG CACGGGTTTT TATTGCACCT CTAGGCGCAT TCAATTATTT ATGCAAACGC TTCGAAGGGG AGCAACAAAA AGAAGGCGAA ATGCGGCGGC AATAAAAATC AAAGTCGGGG CAAATTCAGT TGTGGCATGT GGCATATGGT GAAAAAGGGA CGAAAACTGG AAAAGAATAA CATAGGGACA AAAACAAAAG CCAACTGAGC GAAACCCACA CGAAAATAAA TGGGTAGGGA AACATCCTGA TGGCCATTGA CGGATGTGGC ACGCGTTTCT CCTTTTATAT TTGTTTTATC CTTATTTTGT ATTTGCGGAG GCACTTTATA AAAAATCACG TAGCCGCCAT GTAGTCCTAC GTTGGCCAAG GCATCGAGCT GGCGCTGAGC TGGTCCCACC GACGATTGAG CATTGAAAAT TTAATATTTA ATCTTAACGA AAGACATCCA TTACAATTAC ACAATTGGGT AACACGCACC ACAAACACAA CACTCTGTAC ACATTGAAAT TACGGAGCAC TACGAACCGC TACTGCTGAC TTCTGCAGAC GAACTGAGCG CGAATTTAAT GAGCTGCTTT GGCGAAATCC GATGAACTTA CATACATCAA TGTATATGTG ACAATCCGAA CAAAAGCCAC CACGACGACA CGACC