Vienna Tile Information
VT ID VT018278
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203110
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 218278
Nearest Genes
Gene Nr FlyBase ID Distance
CG43323 FBgn0004377 2738 bp
Sequence Length 2171
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GCACTTTGGGGCTTCGTGTTAATTCC
Right Primer AAAGGAACACCCCACCGTCCGTCT
Template genomic
Sequence GCACTTTGGG GCTTCGTGTT AATTCCTTTC TATTGGCGCC TTATGAAATA TTTACCAAGT GCACATATTT ACCACAGCAG GCCCAACTCA TGTCTGATTA ATAATAGTAG AGTGAAGTAT GGCCATTAGG GCATGAATGT TTAACGAGTC ATTTACGTGA AAATGTTAAA TGTCAGCTGT GTGCCACATA CAATCACGCC AAGATGGGGC ATCGCACATA CGCCGTGTTG TCCAGCCTAT TTGCAGTTCA ATAAACCGTT TGTATTGGAA ACTTCGTTTG CTTTGTTAGA GATTATTACA TTTTCTGGAT AATTACTGGG TTAGCGAGCA AGTGAAACCA AAAGTTTTTG GAATCCTTAT CAATAATTTA TTGCTTCATA TTACCATATT TCCAAAAAGC TGCGATTAAA TTCCTCCGAA GCGAGTTCGT TAATTCAATT GGAATGGGAC CTGCGACTCC TAGCTCACCT TCACAATAGT GAGTTAGTCG ATGCGGTGGT CAAATAAATC AGAAAAAACC CAAAAGTCAC GCGCCATACC ATCCACCCTT AACCTTGACT AATAATAGGC CGGTCGAAGT GTGAGCTCCA TCAAGTTCAA GGCAAATCCA CAAATTCTGG AAATTCGCAG GGCCCACAGC AAATGGAGCT CATAAAACAA TGGGAGCTTT GTTTCACTTT GATTGATTAA TTGTGATTCC GTTAATTGCG AGCTACATTT GGCATCATAG TTAAGCAACC ATATCCTTGA AACCTTAAAA TATATACGTG TTACTTGTTA TTGATTAATT GCTACAATAT ATTGTACAAG TAATGTATGG GACATTAAAT ACAATTAAAA TATATCTTCT CAGGATTGGT AGCGCTGACA CGCTGGAAAT CGTGGCCTCC AAGTCCACGG GCAGCGAGGA GTGCTCAACG CCGGAGGACA ATATTAACGT GGTTGTAAGA GTGCGTCCTT TAAACGACAA AGAGAAAAGG GATCGACATG GGTCCACGCT TCAGTTTCCT GGAAACGGCC AGGTTATAGT ACGTATTATT TTTACGAGCA TTTCAACATG ATGCTTAAAC CAATCCGCTG CAGCTTGAAG GCAACGATGT GGGCCAGAAA AGGTCGCATA ATCGCGATAG TGTACGGGTT TTCACCTATA ACGTGGTATT TGAGCCGGGA GCCACACAGG AGGATATTCT GGACTACTCG GGTATAAAGC GCATCATTGA AATGGGCATC GAGGGTTTCA GTTGCACGGC TTTTTGTTAC GGCCAAACGG GATCCGGCAA AACGCACACC CTCACTGGAC CCCCCGATTT GGTCAGTCCA GGTCTGACAG ACTTGTAAAA TCCGTAAATC CTAAGTTGTT TCTTTTCTCT TTAAGTTCGT TGGCAAGCCG AATCCCAAGG ATCCGCGTCA TGGCCTCATC TTCCGCTCGT TTTTGTATCT CTTCCAATTG ATTAAGAATC GCAAGGACGT CAATTACGTG CTAAAAGCCT CCTTCATGGA AATCTACAAT GAGCGGGTAA GTGGCGCCCA ACGAGGGACC TCTAATTTGG ATTGACCTCT GCAATATCAA TTTAAATCCT AATTGCATTT GCCATAATAC CGATTGCTTG TCCGCAAACA TGCATTCCAC TGACCTCCAT CCATCCATGG ATGTCAGTAC GCTCCACCCA CCGAAAACAG ACAGACTGGT AGTCAATCCA GCTATCGTGG ATTGTCACTA TGCGTGAAAT GTTTCTGCAT TTTGCGTGGC ATTTCATTGA TTTGTTTTCT TAGCCTACCC ACCATTTCCA TATTGGTTTC GCAAATTGAA TTGCATTTTT TATCAATCCC CTAGGTAATC GATTTGCTAA ACCCGGGAAG TGCACGAAAA CCGTTGGCGG TGCGCTGGTC CAAGAAATCG GGTGGTTTCT TCGTGGAGAA CCTTTTCACG GTGGACTGCG AAGAATTGGA TGACCTTCTG GCCGTACTGG AAGAAGGTAA GCAGTATTTA TACATATGTA CATACATTCA TAAAGTAGTT GTTTTGCTCA CATTCTATAT TGTCATTATG GTAGGTATGA GAAATCGTGC TGTTGGCTCT CATGCCATGA ACGACCACTC CTCACGTTCT CATACAATAT TGACGGTCCA CATCCTATCC GATCAGCAGA CGGACGGTGG GGTGTTCCTT T