Vienna Tile Information
VT ID VT001484
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203083
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 201484
Nearest Genes
Gene Nr FlyBase ID Distance
CG8817 FBgn0041111 4895 bp
Sequence Length 2168
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer AGCAGCACCAGCAACGATTTGGA
Right Primer TCATAACTGGCACACACAACCAGACA
Template genomic
Sequence AGCAGCACCA GCAACGATTT GGATCCGGAT CCCCATATGG ATATACATAT GAAAAAACTA ACTAAGCCAC GGTAAGTCGA TTCAGTTAAC AAATTTCACC TAAAGGAATA TCCCACATTA TGTCCTAATA ACCATATCAA TTCAATATCA TAATGCTTAT GCGAAGGCGC CAAGTTAATG GGTATAATCT ACCTTAAGGT TTTTTGTATC ATCATTTTTG GAAAAAGGGT CAAATTAGGG GATTAAATGG GGACAGATAT ATACTTCGAA AAATGAACCC AATACGTTTA GGGCCCAATC AATTGCCAGC TTAATCTCTG AACATTTCGC CATTGTCCGT CGGTGACAAT AAAGCAAATG CTACGCACAC GACATCGAAT CGGATCTGGT AAAAACTTTT CCCATTTCTG CGAAGCGAAC CGTTTTCTTT CCGGTTCTGG GTTCTTTCCC CGTTTTCTCA TTTTTTATTG TCAATGAGCT GCGGCGGCCA CTAAAATTTA TAATTGAAAA TTGTACGCCC ACATTTACTG CGCACACACA CACACACAGG CGGACAAACA ACCAGCCAAA CAAACTGACT GACTGACAAA CAAACAAACT AACAAACAAA CAAGCACGGG CACAAGCAGC ACATCCATAT AATAGATACG TATAAAGAGC AGTCGCACCA AAAAATAAGC TGAAAAAGGA GAGGAAAAAG CGGTCCCCAG TTGCTTTTAG CGCCATGCAA TAAACAGAGC GAGAGAGCGC TGCCAAGTTT TGCGGGTTTT CTTGGCCTGC TCTTTTCCGC CAACTCAGAC GGTTGGCTGA AAGGCCACCC ACCGCCCCCA TTTTCAGCCA TCCGCCGTCG TCTGTTGTCC CACCTTGAAG GAAAGTAGAA AAATCTAAGT TTTCATGCTC GTTTTTCCCT GGGATTGAAA AAGGGTATGT GGCAATTGTA GTATTCGAAT TTGAAAGGGC AGTAAAATCC CTTCAAGGCA CTCAACTGTA ATTAAAATAA CAATTAAGAA AAATGTATCT TTTGGATAGA AATGGGTGTA GAAATGGACA ACCCTTGTGG AAATACCCAA GCATCCCTAT TTATAACTCT ACTACAGAAC TGATTACAGT TGAGATACAA AAGTATCTTG AAAGTGAAAT GGATTCGAAA CGTAGGATTT GCAACTCTTT AGAACTGAGC ACAGCGTATC CCCAAGTCGG AAAATTGCCC CAGAACGCTT TTTCTAGTTA GTTCCCCTCC TTTCTTCGCC TCGTGTTTCG GTTTTGTTGT ACATTTTGCC GGCGTCGCCA CGCACTGTTT CCCCATGGCT AAACCATTGT GCACTTTTCG CTGCAATTTG TCGAAAACTT GGCATTTTTT CTTCATGCGA AAGTTTAACC ATAACAGATT TCTTTAGACC ACTTCCTCGT CGTGAAGGGC GGGACGGGGT CATCTTAAGT TGAGCTTTAG AGCTCCCTCA AAACTCTTGA GCCCTCAATT GAAGCTCCGA AAATTTGCCA GGCTCAAGAA GTTGAATGCA GAAAGGATGC ATAGTTTTGG GTCTTCTTGG GCTACTAGAA ATGAATTATA TATGAAATTG GAAATAAATT AAAGCAAATT AGAAATATGA ACCAAAACGG TTACTTTATG ACTTTGGCTG TCTGCATATT AGTTTTGTAT CCACAGGGTT TGCGAACCTA GAAACATCAG AAACAACGAG CGAACGAAAC GTGTGCGACA CTCTCAACAA ACTGATAAAA TTTTAATTTC TCCAAAATTG AAATTTTAAT GTGTGTCTAG ATCGCGGTTT ACCCCCGTTC AGCACCCCTT TTATCCACCA ACTCGACTGC ACTTTGTGTT CTCCTCCTCC TCCTCCTGCT GCCTGGTTTT CCCACCTTGC CGGGAAAATG TGCTGCTACA CCCTATGTGT GGCACTTCGC CATACACGCG CACAAGTTTT GGGTTTTTGC GGGTTTCCCC AACCCAATCC AAACCGACCC AACGCAGCCC GGTCCAACCA CCACCCACTT GGCTGCCCGC ATTCTATTGC ATTTCGGTCG CCCCCTCTTT GGCCGACTTT CTATCATTCG CCGCCTTTGG CATTGGCCAA AAAGCGAATT TGCTCCGTTG CGTCCACATT ATAGAGTTGA ATTATTAAAA TTTGTCTGGT TGTGTGTGCC AGTTATGA