Vienna Tile Information
VT ID VT000629
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203081
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200629
Nearest Genes
Gene Nr FlyBase ID Distance
CG5423 FBgn0041097 30178 bp
Sequence Length 2095
ON Targets 0
OFF Targets 0
Viability lethal
Inserted Chromosome 3
Left Primer CGTAGGCAAGCCCTCGAACTCGC
Right Primer gacttcattctgctgctcttacttcataGGGT
Template genomic
Sequence CGTAGGCAAG CCCTCGAACT CGCGACGCAT GAGAACTTTG GAAGATGGTA AGGATCTAGT GTGCCATCCT CTGCTCGTTA TTGAATCTAT TTCTTTCGGA TTTATTATGA TTTATTGCTT ATCTGCTGGC ATTAACTTGG CTTCAACTTC TTTCGCAGTT CCGGAGGCAC CACCTTATGG CATGGAAGCC ATTCAATTCA ATCGCACCTC GGTCTTCTTG AAGTGGTTAC CTCCACAACC AAATCGGACT CGCAACGGTT AGTAAATATT TTAATTGTTA ATATAAGCTT CTGAGCAGGG ATCTTGAACA TTGGTTTGAT ATGATAACTG GTTTTTGGTT ACCAAACCAG AAATGTGATA GACCCTGTTC CGATTCCCTT ATAATTGAAC CACCAAATAG CTCGGCTAAA TCCACTCGTT GCGGATGAGT TCTCAGCTCT TTGTTTACAT TTAATTTCAT TTTCTCTGTC CAACCGCCCA AATATCCCCG TGGCACAGGC ATCCTCACCA GCTACAATGT GGTCGTCAAA GGCCTGGACG TGCACAATAC GACGCGGATA TTCAAAAATA TGACCATAGA CGCGGCCGCG CCCACCCTGC TCCTGGCCAA CCTCACCACA GGAGTCACCT ACTATATCGC AGTGGCGGCT GCCACGCGGG TGGGAGTCGG ACCCTTCAGC AAGCCTGCCG TGCTCCGCAT CGATGCACGC ACCCAATCCC TGGACACTGG CTACACGAGG TGAGTGGGCT GCACTGGGAG AAAAAGCCAT TTTTGTACTC GAATTAAATA TAAATCGAAA TAATATCGTA ACTAATCACT TGTTCTGTGA CTTAATTTTA TAATAAGTTA CATTAATTCG AGATACTCGT TCAGTATGCT GGAACCTTTT GTTAAAATTT TATTTCACAC CCGAACTTTC GCCAAGTGTA GGCTTTGTGG GCATCGGGCA TTGTGGAGCT GCTCATTTGA CTGCCAAGTG TCGCTTCGGG GTCCACATCA ATCCATTAAC GGCCAACGAC AATGGCCAAC GACTTTTGCG ACCATTAAAC TAAGCCTCCG CCCGGCACGT ACGGAGCTCC ATCCTGGATA GCGTTCTCAT TCCGGGTTCT TTATTGTGTG CCTATTGCAG ATACCCCATC AGTCGTGATA TTGCCGATGA CTTTTTAACG CAGACCTGGT TTATCGTCCT GCTGGGCTCC ATCATTGCCA TAATTGTGTT TCTATTGGGC GCATTGGTTC TATTCAAGCG CTACCAATTT ATCAAGCAGA CCTCGCTGGG CAGTTTACAT GGTGAGTGAA CTTTAATTTA AATTTATACT TATTTCCATT TTGTGCACTT CTTTTGGGGG GGGAGCTTGT TCTTTTTGTG TAAGGATTTA CGGGTGAGTT GATGTTTAAT TTACTCGCGA AATGGGGGAT GTTTAGTCGG GATAATGGTC GTAGTATTTA AGGTTTAAGC GGCTTAAAAA CTGTCTATAC TCTAAATGAA CATTTATGAT CACAGCCATA AGTATCGTTT GCGTCACGAA AATGTTCAAA TATAGAATAC AATTTGCATT CTCTGAATTT ATTTTCCTAT ACTAGTATTC TACCTCTGAG CTCCTTCATC TGGATGTACT CCCCTCTTTT ATTGGACCAT CTCCATTCCA GCCTGGGACA TGCAAGCGTT TTGCTTCAGC TCCTCCTCTC CGTAATCTAT GATTTATGAC TGAGCATTTA TGGCCGGTCT CAATTAGGTT GCCATTTTGT AAGCCACAAT AACTGCAGAC ATCGAGACAC GCACTCATAA CATTGTACAG ACTCGAGAAC CAAAACCAAG GGTAATAATC TTTGGCAGTA AGCCACAGCG CCAAGATTAA ACCGACTATA AAAAGATAAA CAAGCCACGA TAACTGGAGC AGAAGTCGTG GAGTCTTGGG GGTAGTCGTG GGAAAGGGTG GGGTTTATAT GGCTTATAAG AACGACAAAT GCTCACGTGA AAATCACATC AATTGTCTGA CTGGGAAATT CTAAATATAG TTAGAAAACA AGTCGTTTTA GCTGACTATG GGGAACTAGG GATACCCTAT GAAGTAAGAG CAGCAGAATG AAGTC