Vienna Tile Information
VT ID VT060731
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203071
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 260731
Nearest Genes
Gene Nr FlyBase ID Distance
CG15732 FBgn0030385 7717 bp
CG32651 FBgn0052651 20550 bp
Sequence Length 2386
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CGATTTAGGACTGGACGAGCCCCC
Right Primer GGCCGCAGAGAGAGATGCAAGAAC
Template genomic
Sequence CGATTTAGGA CTGGACGAGC CCCCATGTAA GATTGTTTAT TATTATTATT TATTATTAAT TTAATTATTA GTTTAATTCT AAATGCGGTA ATTATATAAA GTATTCTTAG TTTGTGACCG AACGACTGCT GCTGAGAACT CGACTGACTG CAACGCTGAC TTCCACTCCA CTCACTGCTG CCTTGCGATC GTTCCTTCGA TGACTGATTG TCGATAACTT CGATTTCCGA CAATCATGTT GCTGCTCAAC AGCGCTGCCA ACCGGGTTGT TGCCAGCCTT CAGCCTTACT CCATGTTACA TACATATATT TATTAATATT AATTATTGAT TGCAGTGCAC CCCCATACGT GTTTGTTGCC GTTTACATGT GTATGTGTGT GAATGGGTTA AATGCAAGTG CATGTAAATG TTGGCGCCGT GGCCAAACAA TAGCCGCTAG TTAGTTTGCT GGCCAGTTGA TTTCCAGTTG ATTTTTTTTT TTTTTTTGCA ACTATTACGT CCCGATCTTT AACCCCTTAC CACTGTTTTA CGCCACGCAG TGCCGTCTCT CTTTTTTGTG TGTTGCATTA ATTAAAACAC AATCATCGCA AAATTATGCA TGCCGCTGCC TCATCGTTGG ATACAATTAT TTATTGAAGG CATTCAAATA AATAACAATG CTCCCCCGGG CGAAAACCGC CCAAAAATCC TCGTGCATGG ATTTTCACTA GTTGATTAGC TACCAGAAAA TTATGCAAAA ATTGGAAAAC CGTCAACGGG TTTAGTCATG CGGTGTAATT TGGAGTGCAA AAAGTGTGAA TATTTCGCTA TTAAATAATA AGTTTTTGTG CTATTTACGC AGCAAGATTC GAATTATTTG TTAAGGACTT TTGTGTAAAT AGCTTTCGGA AATTTGGTTG TGTTATTTTT AAATTATGTT GCACTTTCAA ACACACCTTG AATTATTAAG AGCTTTGTAG GGCGACCCCT AGCGAACAGT GAGGAAAACA TGATTTTTCA GACCACAGAT GGCGCTATGC CGAGCTAAGG ATACTTTTTA GGGATATGGG GTTTTTTATT AAAAGGAAAT AAATAGATAT AAGTGCTACA AGATATTTAT ATAAAGTAAT TGCCTAAATA TAAGTGATAT TACGTTTTTC TCTTTTTCAG AAATAAATAT TGTGAAAATA AATAAATCCC AATCATTTAT CTGTTTTAAA ATGGCTCGAA AAATAAATAT AGCTCAAAGA AGCAGGCACA GAATGCAACA TTTGTAAGCA AATGCACTCT TGTTAATTAC AAATGACAAT ACATTTTAAA TGCCTAGCAA TGAGAAGCTA AAATACAAGT ACAGTTGCTA GCCGTTAAGT AGTTATAAAG CATGTTGAAC AGCAGTGATG ACAGTCGAAT CGGCAGCAAT CTGTAAATAT AAATGCATTT AAGCTGGTAT ATGCAACTAA GCTGTAAGTA GCAACGAAAC TCCACAGAAA TGCACCGAAA TGCAATGGAG CTGCAATAGC GGTAATGACA GTAACAGGAA ATCAGTTAAG ACAGGATAGC AACAATACTA ATTACAGAAG CATCGACGGT GCACTGCGCG AAAATGTTGG GCTGAACGAG AATGGATGGT AAATACATGC TTGCAAATTT GTAAACAATA GTATATACAC CTAATGAGGT TTATTATTTG TAAATGATCT TGTAATTATA CCAAATTATA TATATTATAT ATCAATTATA TTTGTTTATA ATATTTTCCA CTGTAGCAAG ACGCCGCCAA ACAACAGATT TAATTGCAGA TATTGAAAAT CAAAACATAA ACGCCCGTTG AGCGCATTGC AGTGTTTTGT GAGTGAGGTC AGTGGGAATG GGGATAGTGG TCCGAACTGT AAATCGTATT AAAATAATTA CATTTAATGG CAGCCGATCT CTCTGGCCGA AACTCATTTG TTTTTATTAA CGCCACATGT AATTGCAACC GATGCAGTTG CACATTGCAT TTTGCATGTT GCACGTGTCC AGCCATATGG AAGTGCAGCG GGAGGTCTGC GATTGGATTT GGTTAAAGGC CGGGTCGAAT AGTTAACGAT TATTTAACCA GAAGGAATTA ACCTCATTTT CATGGTTTCA TAATTAATCC AATTTGTTCA ACATATAAAT TTCGCTGTCT CGTACTCTTT CCTCATTTCT GTTCACATTT TTCTGTTGGC CTCCTGTTGG CCTCCTGTTG GCTCTTCTTC CTCCTCCGCC GACCGATCAT AATTGGAAAT TTATTATCCA CCGCGGAGTT GTCGACAGGG GAGTTTTGCT GTAATCAATA TGCAATTGTG TTGCCATCTC TCTCTGTCTC CCTCAGACCC CTTTGTTCAG TCTGTCTATT AAGTTCTTGC ATCTCTCTCT GCGGCC