Vienna Tile Information
VT ID VT016847
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203048
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 216847
Nearest Genes
Gene Nr FlyBase ID Distance
CG10197 FBgn0001319 12615 bp
Sequence Length 2098
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TCACAGAGACCTTTTCTTTTACGGCCA
Right Primer TGTTCGTTATGCATACAGCGGAAAGAG
Template genomic
Sequence TCACAGAGAC CTTTTCTTTT ACGGCCATTT TTTTTTCGTG TGTGATATTT TTAGCAAATT CAATTGGTGG CTGCTCAAAT AATTTTGCGA TTAAATTGCA TTCGCACAAA TGGATTTGTC ACCATAAAGT AAAGAAAAGG GGGCGAGATG TCGCATGCTG TCGATAATTT GTGGACAAAT TTATTGCGCT CTCGTTTTCT GATGCGAACG GGCTAAATGG GCAAGGAACG CCCACAAAAA CGAAGAGAAA TCGAGAAAGT AGTGCCACCG ATTGGAGTGA GAGAGAGAGA GGGGGGGGGG GTTAATGGGG AAGAGACGGC GAAAGGAGTC GTCCAATGTC TATAAAAATT TGTCACTCGA GAAATTAATT GCCCTTGAAA AGGCCGAAAA AGGAGAGGCA AGAAAAAGGA CTCGCAGGGC ATTAGGCCGA CAAAAGCGGA CATATGGTGC AGCAGGACTA TAAGGACCAG TATAATGCCC CAGGACCTGC ACGCACCCAC AACAAAGCGC ATTAACAATG TTCGATCCCC GTGCGATTCT CTCGATTTGC TCGCTTCTCT CGTTAGCCCC GGTCACACCC CTTTTTTTTC ACGCGGAAAA GTCGGAAAAG TCCTGGCCGA ACGAGCTGCT CGTTTGACGA CTCAATTTAT TGGCCAAAGG ACACACCAGG ACACACTTAA TTAGCCATGA CAATCAATTT CGAATGCAAC TTATGCTCGA ATCAGCAAAA CAAACATCGT GTCCGGGAAA GAGGGAAAAT GCACGGAAGC AGCCAAGTGA AAGGAATTGG TTTTTCGTAG CCTGGTTAAC TTTGGCCTTA ATTTGCAGTG AAGCAGCGTG GCAATCAGGA AGTTCTTAAT TTATGTAAGT GGCAATCGCA AGATGAATTG CTAATTTTCG AAATATATTT AAGTGGTTTT GAAGTTGTTT CGAGTTTTCT GTGCAGGAAA TTACTCAACC TATTCAAATT AGATGTTTGG GCATTACTTC TTTCAAGTTG TGTAAAGGAT TAAAACTTGA GTTGTTATTA ATGTATATTA TTTATGATTT TCTAATTTTC TAAACATGTA TGTTCCGTTG CTAGTTATAG CACCATTTCT TATAATTTAT GTTGAGTTCA TCCATAACTA ATTGAAATAT TTTTGAACTC ACCTGCTTGG TCACCGAATC GATGAGACGC ACGAAAATGT CCTGCTCCTG GCGAGCTCCT AGAAACGGAA TATAAAGCAT AGGATCACAA AGGGTTCCAT CTTTAATAGC ACTTCGCACT CACCATTTGC GTAGAGTAAC TGCAGCCGGT ACTGGATGCC ATTGTTCGTC TTGGTGGCAT CCGATTCCGA GTCCTTCTCG ATGAATCCAA TGAAAGCCGT CCGCTCGATT TCGATCGGTT GTCCAGCCCG ATCATATAAG GCGATCACGA AGTGAAAGAA GTTCGACTTG CGCAAATTGC TGGGCGGCTG CTTTTCAAAG TGGGCGCGGC CAATGCCCAA ACTGCAATGG ATCAAAAAAG TAAATAAATG GTGGGAATTA GTGAAATGAG TATTACGTGG GAGAGGAGAG TGTAATTATG CCATTAGCTG GATAAATATA GAGCAGGCCT AAAGAGCCTC TAATTGGCAG CGAGAGTCTA GTTTAGTAGT GACCAGTATT AGGGGCAACT CAATTAGACT AGAGAATGAC ATTCGGGCAG CAGCTCTCAC AACTCAGACA ACTATCATTA AAAGCGCATA AGCAACATCA ACGTGACACA ATAATCCTGA TGTATGACAG TCCTTGTTGT CCGCCGAACG CCCCTTGTGC TACACTTGAA ATATTTTTGT GTGTATGTAC ATTTGCTGTA TGTGGGCCAA GCAGACAGTG GGCAATTATC GCTGGCAGGA CACGTGGACA CTGAGCCGCA GACGGCATAA AGGCTTGTCC TTGCCCCACC CCCTCCCCAA CTAGTCCATA TGCTAAATGT CAGGACCTCG TGTCCCTGCT CCCCTTCCAC CATCAACAAT CCTCCTGTCA GCGAACAATT ACCGGACAAT GTCCGGTTGG AAGGACTAAG GTAGGGTCTT GTTTCTTGTT TCTCTTTCCG CTGTATGCAT AACGAACA