Vienna Tile Information
VT ID VT014724
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203039
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 214724
Nearest Genes
Gene Nr FlyBase ID Distance
CG11895 FBgn0024836 5391 bp
CG12934 FBgn0033541 49483 bp
Sequence Length 2123
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GCGGCGAAATTAAAGACACCAGGA
Right Primer CAGTCGAGCGCAAATCCCATTGA
Template genomic
Sequence GCGGCGAAAT TAAAGACACC AGGATTATCC TGCACCTCTG TGGTACCCGC ACTTATCACT GGCAACTGGC GGCTCGAGAC TTTGTGACAA ACTTTTTGGC CAACTGTCGA TGCTGATTAC CAGGCCAAGC CCACTGCCGC TCCGCCAGTC GACAGCCGGA ACAGTCGGCT GGGAAATAGG ATACGGAGGA TACTGCTCCA TGGCACTCCG CTCCTCGTGT AAAGCACTCT TCAAGTGGCA GCCACTCGCA TTAATAATGC CTGAAGGGCT GCTGCTGCTG TTTCCGCTGG AGGAGCAGGA GCAGCATATA CGCACAAAAG TGTGCACCAC AAGTTGTAAC TTCCAGTGCT CACAGAGATA CAGATACGAG TATGAACCCT AGAAACTCTA TGGACCGGGC TGCAAGCACA AAGTTGGGAT AATGTGGACT TTTGCTATCT TTGTTGCTCG GCAATTCATA TGCCAACTGT GTGTTTATTT ATGCTTACGA CTTTTTGCGT AATCAAGTCT ATCTCTTCAG ATACCCCTTT GAGTACTTTT GCTCCAGGGG CATGATAGTT TTGCGTGATT TATACCGAGA AAGAGACAAA AGAGAAATTG AATTAATATT TATTATTAAA ATATACTAGT TAACAATTGT TAGGCCATAA ATTAAATATT ACATATGTCC AATTAATCAA GAGAAACCAC TGGGGCAAAC GTATTGCAAG TATATTGTTT ATTAACTATC TCAAATGAAT ATTAGATTTC TTGGCTAGAA GTTTGAATTC CCATCAAGAC ACAAACAAAC TGTGTTTGCC ATTTGCAAAC TATAAGGCGC AGAATAAATT TGCAAATGGT TTTCCAGGGA AAATCTCATC AAAGCCAAGC CAAAGTATTC ACTTACACAA ATCACACAAA AACCTATTCC GGCAGAGTTC AAATCCCATT TAAAATGAGA TAACATGTCT TGCATGTACA TATGTGTATT TGATATTTGG GAAAGTAAAC TTTTCCTAGA TTTACTTGTG GGGGTTGCCC CCCGATTCGA ATGTCTTGCA CAACATAATT TTCCGGTCTC GATTTTCGGA ATTGCCGCAG TAAAAACAAC AAGATGCCTT TTGGCCATGG ATTTGGATTT GTTTGTCCAT GATGTGAGTT GCCAAATGTT GCACACGTAC AAACACAAAC TGTTTTGCGT AGTTTGTTTG CTTAAATCGC AGTCAACAAT CGAAATGGAA ATTGTTTGAG CCTCTCCGTG GGCTAATTAC TGGACACTCT GTGTCCATGG CACCTGTTGT TGTTTGTTTG CTTGTCAGCA AATTATTTGT CATTGCTGCT AATTAGGCGT TGTCTTCAGC CTGCAATTGA ATGGTAATGG CACCCCGTTT TCCCCATCTC TACGTCTCCA CATCTATCTA CCCCTTCGGA CAACTCCAAT TGGCGTAATT CCCCTGGAAG GTGAGCAAAC TGGAGCTGGC GCAGAGTCTT TGATTAATGG ATTAGGTGCA GATTGTAGAT TGCTCATACG CTCGGAGTGC TGCTGGTGGA AGGCAAAAGT CATTACATAT TGATAATGCC CAGCCATTGT CTCGACTGTG ACCTACATTG CTGCCACCTA CATCCCCACC ATCCGCATCA CCATCAGCAT CAGCATCACA TCTCTAATTC TTTGTTCTCT ACCCTTTGCC CTGTCTCCTT TTGGCCATAT CCTGTTACGG TAGCTGAAAT CGCATTTAGT GCTTTGCCGC TCCTTGTTTG TCTTAGTCAT TAGCAGAGTT GATAGCTGAT GGGTGATGCC TGATGGCTAG ATCCCCCATC TTCTGCTCCT TCGGCTTCCC GCACCTCCTC TTAATGAAAT CCCACCCAGT GTGCATATGC ATTCCAATGA TCCGATTCAT TGACGGCACT CCGGCTCCTT CCCAGCCATT TGACAGGATT ATCCATTATC CCCTGTCGGG CCCCTTTTCA ATTTACTTAA ATCGCCTCGC TCCGTCGGGA GGATAAATCA CTGGCAATAT TTCATAGGCA GGACTGCATA AATTCCCCAT AAAACTGCGA CTCCAATGCG AATTAAATCG CATTAACATA ATCAACTTTA CAACAACTAT AAAAATAAAT TCAATGGGAT TTGCGCTCGA CTG