Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000252
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202974
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200252
Nearest Genes
Gene Nr FlyBase ID Distance
CG11822 FBgn0031261 1924 bp
CG2914 FBgn0005660 4927 bp
Sequence Length 458
ON Targets 0
OFF Targets 0
Viability lethal
Inserted Chromosome 3
Left Primer TCGTATGGAATAAAGGACCTCTGCCG
Right Primer TACTGCTCCATTCCAAGGTGGGACA
Template genomic
Sequence TCGTATGGAA TAAAGGACCT CTGCCGAATG TCTGCTTACA ACTAGAAGCG AAGGATAACA GGCTAAGTAA CAAATTGGCT CTCGTTTCCG AGTATTGCTC TGCGATGCTA CGGGCTATCA CAATTCCTCA ATTAACCCAA AGTAGCTGGA ATTACACAAA ATGACCTTTT TTACGGCCGA AGCTCTGACC CCCAATAGCT GGGGGACTGG GTGGATGGGT GGATGGGTGG CTGGGATGCA GGGTGGCTCT CCGCTCTTTG CTGCGCCGCA GTGGGTGGTC CTGCGCATCC TCCTGCCCCA TCGGAACTTA CAACCCCGGC GACAAATTGG GGTTGCGGCG TGCTCAGTTG AATGCATTTG TGGTGGGAGT GACCGGGCCC TGGTCGTAGT TTCCCGCAGA AGATGTGGAC GTCCTGGCCG GGTCTACGCC GGCTGTCCCA CCTTGGAATG GAGCAGTA