Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000017
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202973
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200017
Nearest Genes
Gene Nr FlyBase ID Distance
CG31973 FBgn0051973 23443 bp
Sequence Length 663
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GCTGCTGACGTGGGCTGTACAAATA
Right Primer CGGGCGGCATTCCTCTAAACTCAA
Template genomic
Sequence GCTGCTGACG TGGGCTGTAC AAATATATTA GCGGGTTGCG GTGTCCCTAG CGATGACGGT GAAGGCGACT CAACTCTGTT CAAGTTGTTG TTTTTGTTGT TGATGGTTTG TGAGAGTAGA GTTGTCGAAT AAATAGCAAA AATTATATAC ATTGCCAAAA ATTCAAAAAA TGTTATAGGG TACATTAATG AGAGACATGT GGTTTTTATA AATAGGAAAG ATAAAAGTAA AATAAGATTT TAAGAAAATT TCTACAAATT TTACAAAATA ATAAGTACAA AAGATGGATG AAAAGATTGA AGCGATTAGC ACAAGAAATT AGCTGGGGTT AGCGTTAAAA TTATGGTTAT AGTTAAAGGA GCCCAGTCCA GAACATTTGT TTAGTCAACT GTACAGCTTG ATAATTTCGT TACGTGAATT GCTTAGTAGT GGGTCTTATC GTATACGTAT AAACGGTGTT GCCGCCGAGT TGGGCGGAGC GGTGTAGAAT ATATGGTATA TTTACATAGA GGAGCACTTG GTTTCTGTAT TCACTAAATT CTTGTGTATC TGTGTAGCGG CATTATAGAA TTCAACAATC AGAGATTTGT CTCGGCTCAT ATAGCTACCT GTGTCTTTCT GGACTTGAGC CGGCATGTAT TGAGTTTAGA GGAATGCCGC CCG