Vienna Tile Information
VT ID VT027938
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202860
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 227938
Nearest Genes
Gene Nr FlyBase ID Distance
CG10537 FBgn0004244 7837 bp
Sequence Length 2080
ON Targets 0
OFF Targets 0
Viability sterile
Inserted Chromosome 3
Left Primer TGCATTTGACCAGATCACAACAAACA
Right Primer CCTCACACATACAAACAACAGCCACA
Template genomic
Sequence TGCATTTGAC CAGATCACAA CAAACATAAT GAGGGCTATA TGCGAGTATA GGTATGATGG ATATATGTAT GTATGAATAT GTCATAAATA TCTCTCGTTT CTCTGGGGTG GAGGGAACCC ATCATAGTGT CACTGTGTAT GTGGGTTGGG GAAATGGATG AACTTTGGCC GTAATGTACT CGATGGGGCG ATAAATAAAG ATTTATACAG CAATTAGATT GATTGACTTT ATCGCAGTTA TCCATGTTAT CTATAAAATT CCGAAGTGGA TGGATGCGAT GGAGACAAAG AAACGCAAAA GGCAACAAAC TCAGGATGAA CAAATGTTGA AATGGCATTT CAAAGCGTCA AACTCGTAGT TGAATAATAG ATAGAGATAG AGCGCGAGTG TGGGTGAAAG AGAGAGCAGC ACTTGGTCTG GGCTCAAAAA TTAGCTCAAA ATGTGTATAA TTTGGGGTAA TTTCAATGTA AGTATATCAT TGTATATATT TCGGTTTTGC ATTGTTCTGG CCGAGAGAAG CTTTTGAAAC GGAACAACAA ACAATTTGCG AACATCATGG CCTTATTGGC TAACATTGAA ACAATAAACA CAAAACGAAT ATGCAACATT GGAATTTCAT AGTTGGCAAT TGCATTGCAA TAACGATTCG TTTTACACAA CATTTAATTG GCAGAACTTT GTATATATAG GATATTGGTA TATGTATATA GATATTGGTT TGCAGTTGGC TTTGAATGGT CGAAAACAAA CACAATCTTA AGTGAATCAA AGTAATTGTA ATAAATTTTG TATGTCTGTT GCCAATTAGC GAAATTAAAA GGAGAACAAA TGCTAAGACA CAAAATGAGC TTTAAGCAAC AGAGACAGAC ATAGAGAAAG AGATAGAAAC ATATAGTAAA GGAGACAGAG ATATTTATAG AGACAGAGAG CGAGAGATAG TTACAGGTTA GAGGTAGAGA CTGAGAGAAA TTAAGAAGTA TACGAGTAGA TTTATGAATT TTTTTTTGTT TGCTTTTACC AAAAAAAAAA GGAACATTTG TTTTGTATCT GTGGATAATT TTTGTTTTTT TTATTTATTT GTATTTTTGG CATATATTTT TACGTATGTA CCATTAGAAC TTCCGAAACC GAACTGATAC TGAGGACATA CATTGTGACG CCAACCTCCA CAGGGGGACC TGCAACATAT ACACACACAC GGATTGATGG AATTTTCATT TTGCGTTTGG TATGGTTATA CTGTAGTTGT AGTTGTTGTT GTTGTTGTAG TTATTATTAT TATTGTAGTT GTTCATGTTA GATGTGGCTA AAACCCAAAA TATGAGAACT GAAACACACA CACAGCGGTA CGAGTAGTAA CAATGGACGC AGTACGTTGA CATATATTTT ATTTTCGCTG CCTACTTTCG GGCGCCTTTC CTTGTGCTCG TCGGGTGCTG TTTAATTTCC ATTAGCAAAA TTAAATATAT AAGGTACGTT TAACACTTAA ATTGGCAAGC GATGTGCATT GCTTTGCTGT TGTTGTACTG TTTTGGCTGT CTATATATTT TTTTTTTTTT GTAGTGACTA ACTAAATTTG TGTTTGATGC TTTTGCTTCT GTTGATTGCA CGCGCCGAAT GAAAACCAAA TCAGTTGACT CTACTCGAGG TTCACATTAA TGTTGTATAT TTTGCATGTA TTTTCAGCTA TACGAATAAG AGTTGCAGTA GCTCAATTAA AAGAAAGTAT TTCAAAAACA AAGGCGCCTA GTAAATAAAT ATTTATTTGA ACTAGTGGAT TATTTGGTTT TGAATAGCGG ATTCACACAC CATTTTCGTT TGCATTGCTT ATTTAGATAG AGATTTGTAT TTTTTTTTTT GGATTTTGGG TATTGCGATT TTTGGCAGCA GTTGGGTAAT GAAATTTATC TTGAAGCTTG TTATGAGTTA TGTGGGCCTA CAAAAAAGAA GAAGACGAAA CAATACGCAT GAAGTGAGAG GCAAGAGTTT TGCTTGGAAT GTGAGGGTTT TGAGATCCGG AAGGGGTACA ATGTTGATGG ATTTGTTTTG TAACTGTGGC TGTTGTTTGT ATGTGTGAGG