Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000008
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202847
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200008
Nearest Genes
Gene Nr FlyBase ID Distance
CG2671 FBgn0002121 0 bp
CG2657 FBgn0031209 3684 bp
Sequence Length 2228
ON Targets 0
OFF Targets 0
Viability sterile
Inserted Chromosome 3
Left Primer AGCTGGATGGCGATTACCTCTGACC
Right Primer CACTCCCAAAGCGATGTTCTCCACC
Template genomic
Sequence AGCTGGATGG CGATTACCTC TGACCTACTT TTATTTGTTG AATAACATGT TTATACTAAC ATAGGATAAA AAAAATTTCA TATACGTATA TTTATTAAAC TATTATGGTA ATAGGGAAAC ATCTATGGTA TATTTAATTC GAAAATATTT AAAAGGAATG GACAACATTA CGAGCACAAC GATATAATAG AATTTTTAAA GTAGCCAATA CACAAAAATA TGCTGTGGAA AAAGACACTC ACAAAATCAA CCAAGCTTCA GGTACCTCCT CATATTTGGC ACCGCATAGA AGGAGTGCAC AAAAGAAACG AGCAAAAAAG CACCGTAACC TTTTTTATGC GGTGCTTTGT GGCGCGAGTC TACAAAATAC TGTGTGTGTA TGCGGTTTAC TTGTAGTTGC GGTGGAAAAA ATTTACCTAA ATGTTAATGC CCAAAAGTAT GCACATAGGA GAAGACATAA CAAAAGATTC AAAAGGAGGT ATTTATTTAT TCCTCATAAA TTATAAGCTT TCTTCTAACT TCCATAAAAA TGTATTTACC ACCCAAGATC AAAATAAATG ACCCCACAAA ATATACCAAT CGGCTACAAA TACTTAAAAA AAAAAAAATA GAACGGAAAG AGAAAATTGT TTGTTTTACC TTACGATGTA GCGTTGTCTG TCAGCACTGG GCTGCTGCCC TTTTCCTCTG ATAAACTTTA ACATGATTGG TTATGCTCTT GTGGTGGTTT GGTTTTGATG AATAAATAAG TATATTAATT GTGGCCGAAT TTATTCTAAA CTGAAAATAA TAATAAAAAT TAATCAAATT TTCAATAAGT AAAAAATTAA AAAGGAACTT GTATATTTTT TCACTCTTAT GAATAAAACC GAGAATTTAA ATTTAGGTAA TACTATTAAT ACCTTTTATA GATACGGACG ATACGTTTAA TATTATTCTG GTATACTTTA ATCAAAATTT GTTTAACAAA AAGGGTTTTA CATTCTTGAA GTCATAGGAA AATCAGTGGA CAGATAGATC TTGGCTCCCA AGATTTTCCA AACTAGTTGT GCTTATTTTC TTAAAACTTC AAAGATTTGC ATGTAGGCAG TTTAATAAAC ATGTTTGTAC ATATGTATAT GTACATTAGG AAAAATGAAA TGATGAGCGA TCTGTACTCT TTGCAATGTG TATGTATGTA CATATGTACC TCCCTTTAAT GAACTAGCAA TTCCGTCACG CACACGAAAT ATTTTTTTAT TTGTAAATCT TTTTTAAAGT TTGTTTAAAC AATTTAGTTA CTATTAAAGC TCTAAAATTC ATAAATAAAT AATAATAAAT GTATTAATTA GGACAAAAAA CAACTTAAAA CATATACGTT TATTTTTGTA AAAGCGTTTT AGGCAAACGC TAGCTGGTCG GTACTAATAT TTTTTCTAAG ACTGTATACC GTATACATAC ATTTATGTAC GTAGGTATGT ATCCGTGAGT AAGCTGAGGT GCAAAACCGT ATCACCATTT GCTTTTCGGC TGATAACCAA TACCAAGTAA GTCAACTGTT TCCCAAATGT ATCTGCATAA CAAGGTGATG ACCTAATTTT GAGTACATAC CGATCTTTAC AGTTGACCAG CTTTGCGATT GCATACCGGT ATCTGTTTAT TCACATATAC ACACACAAAT TGCGTGTTAG ACAGACAGCA AAATGACGAC TGTTAACTGT TGGCGTGGCT GACTCACCGA CTACGCCTCT ATGCTAAGAA CATACATATT TGTGGACACT TTATTTAAGA AGTTTGAAAT ATAAATCAAT TGCCTAATCA GTAATACTGT TGTTGAGCCC TTTACCTTTA TGTATTTCCG TTTGTACGGT TAAGGCGGTG GCCGAGTAAT TTTTTGAACT ATTTTATTTG CTCACCATCA CGCATAAGTT TGTATGTATT CTTATGTTGA GAAACGCCCG CACTGTTCTT CACATCGTTG CTTTAAATGA GAATAAATGA AATAAACGTG TCAACCAAGA ACACACAGAT AATAATACGA CCGGTCAGAG CTTAACCGTG TATCTGTTTT ATAAAACGTG AACAATATTA TTAGCCCAAA ACGATATGCG CGTCATTTTA ACACACACAA AGTCGCGATC GGTGGGTCTA GTGTGCCCGT GTATCTCTAT CGAAAAAATC ATATATTTTT TAGAAGGTAT ATTTACCATG ACTGACTGGA ATGGGTGGAG AACATCGCTT TGGGAGTG