Vienna Tile Information
VT ID VT017183
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202846
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 217183
Nearest Genes
Gene Nr FlyBase ID Distance
CG8180 FBgn0034021 10313 bp
CG8179 FBgn0034020 12140 bp
CG34318 FBgn0085347 12140 bp
Sequence Length 1452
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GCCCCGCTTAGACCACAACACTAAA
Right Primer TGACTGACTCTGATGCAATTAGCTTTTAACCA
Template genomic
Sequence GCCCCGCTTA GACCACAACA CTAAATAAAA AAAAAAGAAT TGAGAAGACG GGAGAACACG GGGAATTCTG CACAAAACCC AGTCTATGAA ATATTCACAC ACTGCACCCA ATTAAGTGTA CGATATACAT ATGTATCGAG TATTTACGAT CACGTCTAGG AACTAAGGAT GAATTGTATT GTATTGTAAA ATGAATGGAA TCGACGAACA CGAAAAACGC CCAAATCTTA TGAGTATGTA AGCAAAGCCG AAAACTTGAA TTCAAACAGG ATAACCGCTC CCGGCGGTCA TCTCAACTGC TGAAATTGGC ACTTAAGTAT TTAGGTATAC ACACCGCATA TGTATGTACA ACTTAGTAGA AATTTCGACT AAACTAAACT GAACTTGGAA ACGTAGCGCG ACATTTGTGT AAGTCAAAGG TCCCCGAGAG CCCGTCGATG GGTTCGCTTT TCGAGGGGCC AACTTCGCAA AACAGCTTCT GGTTTTTAGC GTAAGTTTTG TTTCACATAT ATACGATTAG GTGACCAGCA TGACGATACA CCTGGCGCAC CTGCAGGTAG CTAGCGAATA ACATACATAC ATGCATGTAA ACAACAGTAA CTAGAAAATG GAACAATATA ATATCAGTGC AACGTAATAT ATCAGTTAAA ATAACAGAGG CAAACAGAAC TCCACTCATT TAGCACTACT ACCTGCAATT TGAATGTGAA AAACAACACA ATCCCCTCAT CCCAGCCCCC GCTTCTCCGA CGCGTCCCCA TTAATTTACC TGAATTGCAA ATAAAAAGAT GTTCAATTCG ATGTGAAAAA ACAACAACTG TGTTCTGTGT GTTTTGGTAT GGGTTGGTTT ATTTATTCAC TCCGCCCCGA AAGTAGGCAG CAAACTTTAC AGCACAACCG AAGTGCACTG AAGAAAAATA GAGGATTAAC ACGAGATTTA TTTCAACTTT TAAGATATTC AATTAAAACC ATGCAGCTCA ATCGAAGTTT TCTTGATAGA AATACTAAAT TTCATTTTGA GGAATAATAA TATATAAATG CAATTTTTTC TATATTTTAC TATATTTATA AAGGATTCCG CTGTAGTATC CCCATATTTC ACCAAATACA CGCTTCACAG CCGATACTTA CACACATTGC TTTTTATTCA GTTTTAAATT TATATCACAT TAAATTTTAA ATTAACAGAA TTACAAAAGT TAGTCGATTC GTCAGTTAAT GCTGCTGCAA CTGCAGTTTT TTCTTTACAA TCATCATTGT TATTACATTT TCAATCATCG GTAGCTAATT GGTTCTGCCG TCTGGCAAAG GCGTCAGCGG CGTTGACAGG ACGGCTGGGG ATGGTATCTC GTAAATCGTT AGCATTCACA TACATAGTCA AACATTTAAC ATAAAGTCAC ACTTAAAACT ATCACTAAAT TGGTTAAAAG CTAATTGCAT CAGAGTCAGT CA