Vienna Tile Information
VT ID VT030598
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202828
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 230598
Nearest Genes
Gene Nr FlyBase ID Distance
CG7906 FBgn0036417 4633 bp
CG17697 FBgn0001085 30880 bp
Sequence Length 2113
ON Targets 0
OFF Targets 0
Viability sterile
Inserted Chromosome 3
Left Primer CGCAGCAGCAAAAGTGGAGCTTAAAA
Right Primer GCACATTTCGTGACAGGATGATTGA
Template genomic
Sequence CGCAGCAGCA AAAGTGGAGC TTAAAACAGC TCAAGTGGAG CCCGTCTCCC GACTCAGAGC CTACTTGATT ATTTATTAAA ACGAAAGTTA AACAGCGAAA GGAAGCAATT TTCCATATAA AAGAAGCGGA GTTCGCTGCT GAGGAAGCCG GGATTCGCTT GGCCATGTGT CTATGCAAGT TTTGTGGCCC CCTCCAGAGC GTAATTGCCA TGTTTAAAGT GTGATTAATT TGTAATCATC AAAAAGGCAA AAACAGCCAT GTAGAGAACA GCTCTGCAGC TCGGTGGAAG CTCGGCAAAT GTTTGCATTT TAAGTTGCCG GGCAGAAAGG CAGAAACGAA ACGAAGTCAG AGTATAAAAG CTAAACCAAA AGACAGGAAT CGCTGCCGCC TCAGGATGGA AGAGGGGCGT TAGTCGGTGG GGGGGCGTGG CGTCGCAGAA GAAGTGCGGG ACAACAGCGT GTTCTCTAAG TAATTGAGTT TGCTCGCTGA GGCGTTGAAA GTGGCCGAGA ATCGGGGAAA TCGGGCAAGT GGAGGCTGTT GAGATAATGA GCCAACTAAG ATACATATAT GCATAAAGTT GAACACTTTT ATGTTGCGGA ATAGTAATCG AATCGTTGGC CAAAACAAAA AAACTTAGGA TACTATTATC CTTAAAACAT ACCCATTTAA AAGATAGCAG GAAAGCTTAT CTTCAAAGAA AGTTAAATAT TTTAAGATGT TATGATAATG AGGACATATT TTACATGTTA ATTCACAAGA TTGCTCTGTT ATTTGTATAT GCTTTGTATT TCAAGATTCA TATGAGTTTC TGTTATTTTA TTTTAATAAA ATGAAAGCTA GCAATCGATT CACATAATAC CTCTTATTTT GCCAATGTAT TTCAACTCTA ATTATGGCCA ATCTGAGAAG TGACCAAACA TTCTTTATCA ATCGTTTATC GATCAGCAGC CATGATTGCC AATTTAATTA GCTGACAACT TTATTAGCAC CTAAGAGAGA GCAATGCGGA TGGTTTTGGC CAAGACAGCG CAGTAAACAC GATTCTCAGC TGGCTACGAC TAATTACAGA CACCGGCTGT TCGAATGCAT CCAGTAGATA CGCGTACGAG CCATAAAAGC CAATCGCGAA AGCATTGCCA TTAATTAAGC CAAAGTATAA ATCTCGCATT GCTCCAAAGC CGAAAACCAA ACAAAGCAGG AAGCTGCCAA AGTCATCTAC TCAGACCGCC TGCCGCGCAT GCGCAGCTCA GAATGGCCAT CAGAGTCAGC TTTCAGTGCA AAAAATAGCT AGGAGAAAGG AACATTTAAT TAACTTAAAA ACTTTATGGT AAGCTATGAA TGTTTCTTAT AAAAAAAAAT GCATTAAATC AATTGGCACA ACTACGTTCC CTTATTCCAG AAGATCAAAT AATTAGGCAA AATCGAATTT AAAAAAATTT TATCAACATT TTATTGACTG AGTACTGCGC CCTAAGAGGG AATATTAATT TATTAATTTA AGTCAACATT TTTGGTCTTT TGCGCAAGTT GTATATGATT GTGAAATAAA TAATATATGT TTTACTTAAC TATCCACTAT GATATTTAAA TATTTTACCT TCCACTTGCC TAGACGCGCT TTAAAAATAT TTTTTTCTTT TCGATTGGCT GCATAACTAA ACGGCTACCG GCTTTTGACC TTTTGAAAAT AGCCAGATAA ATTTTCCACA GCACTGATGG CCATGAAGCG AAAATAATGG GGAGGGGCCG GGAAAAGGAG GCAAAACTGC GGACCCGTCC AGCCCGACAT TCCAAATAAT TACAAGCTAT AAAAATTTAT GAGCGCCAAG GATTTTCTTT TGCCACCACA AAACGCGAAT GCGTGTGTGC GCCCGGGGCT CTGACCAAAA GAAGTATCTA CGTATCTCGC AGATACAACG CGCTCACCCA TAAAACAGTC GCCTCAACTG CAGTTTGTCC GAGTTCCTCC TGCTGCCGGT TCCTCCGCCG GTTTTGGCAA GCCTTTTGTT CTGGTTTTGT GCATTGATTG AAAATTAAGT TGTGCCGATT GGGTGGCGCA CTCCTCAATC TATCGGCTGA TTTATCATTC AATCATCCTG TCACGAAATG TGC