Vienna Tile Information
VT ID VT029570
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202827
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 229570
Nearest Genes
Gene Nr FlyBase ID Distance
CG4300 FBgn0036272 1064 bp
Sequence Length 2113
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer ATTCTCCAGGCTCTTACCGCTCTGC
Right Primer CGCATGCACATATAAACAAACCTAAGTCAA
Template genomic
Sequence ATTCTCCAGG CTCTTACCGC TCTGCGGATG TCCGTTCGAT TTTACATAGT AGTATATTGT TTTTTTTTTT TATAAACCGT GTTGTATTGA TATTTTCGTG TTGTTGTAGT CGATTGTCAA TTGTTGAGGA ACCAATTTAT GAGCGAGCGT ACGACGTGGA GCGAATACGA GTACGAGATC GATTTCGAGG CGGGGCAGGT GACACATGTG CGTTGGGGCG TAAGTATAAT TCAATAGTTT ACACATTTAT TCACAAGTTC GTGGCAATTT TGGTGTGTAA TTTGGTCCAG GAGATGGTGG CAGCGGTTGT TCATGATGAT CGATGGATCG GTTGAGTGTC GATGGAATAG ATATGAAAAT AAAACGTAAT TTAAATTAAA TAATAATCTT AGAACAGTGG GTATGCTAAA TTGCAGTGAT GCCAAGGAGC TGATATAAAA TCAGCGTGGA TACATAAAGG TATAAAGAGA TTAAACCCAC AGTACAATAA TATGAGCAAC TTGGCACCAC TACTGCAAAG GTAGAAGGCT TCTTCCAAAG ATTAGACAAA CTAGCATGCA GGAGTGGCCT GGAAAAGTAA TCCCCTAGAA GGTAACACGC TAGGCTAACA TGATCGGTGG CTTTGGAGAT GTGCAGAGCT TGGGAGGCGG TTCAAATTCT GGGCTGGAAA TGACAACTCG GTGAATTTAC ATCAGCTGCG ATACGGTGTC CAATTTATGT GATAGTCATG AGGGTTTTTT TTCTAATTTT ATTTATTTTC TTTGCGGTGG CGGCAATCGG AAATACTAGT GGAAAAACTG CACAGGTGTT CTAGATTCTG CAGTGGAATT TTGAAAGAGA ATTTCGGCAT AAATTGTAGG TAATTGTATG TGAAGTGAGT TTGAGTAGAT AAGTTATATA TATTCATTGC AAATGAAACT AGCAGGAACT AAACTGGATT TTTTTTGATT GTACATATAT GTAGGTTGCA TTAAGTTCGA CCAACCTGAG CTAGTCATAT ATATGTCGAT ATATCCGCCG CGTTTAATCG GCGGCAAGTA CTTGGACCGA TCGGAATCAA ATTTCTGCCG CAAAATCAGT TCCATGGTGC GCATGGTCTG CAATGGTAAT TCCATTATTG AGGTCCTTCT TGCAAGGGGG CGTCGGATGT ACAAATGTGC ATGTTGGCTC GATGGGGGCT GGGGTACTCA GTATGAATAA ATTATATTAA TGGAAGGTGA CCTTCATCCG CCAGGCGCGG AAAACTCTTC GAACGACCCA CCCCACTCAC ACCAAACGGC GACACACAGG CAGCCCGGCC CAAGAAAAAT ACTATTTTTA GTCCAAATAC TTGATACTTA TGAAAAAGGA AAGTGAACAG AACGAAACGA AAAAGGGAAT ATATACCTAT ATCTAGATAT AGCTAGTAGC CATGCAAGTA TGTGCATTCT GGCGACACAT TTGTTTAGTT GCATGTGCAG CAGGCATATG TTATTGCAAA ATCACAGAAA TCACAATAGA AGGCTTAGCC ACATGCGGCT TGCGAAATCC ACAGGCCAAC AGCAAACAGT CGTAAGCAGA AAAAATATTG ACGGCTAGAT AAGAAAAGTT CCGCACTCGC GAATAAAACA GCTGCGATCG GCAAGATATA GCATTTCAAA TGATACGAGG AAATAATAAT GGGTCTGATA ATATTAGTTA CTCCTATAGA AAAGTTGGTT TAGGTTGATT TCTTTGTTCG ATTACTTGAT TAAATTATTT ATAAAGTACA AAGGTTTGTT GAGATTATAT CCTAACTAAC TCCATCATTG TATAAAAATA TAATTTTATA AAAATTTTAC TTGGGATTTT GTTAAAGCTA TAGTTATAGA ACAAAACAAT TTTAGACTTT TTGACATAAT TTAATTTTTT TGATGCTATT TAGCTTACCG TAGCTGTAGG CATATGTACA TGGGACATTT TCTCTAGCAT TTTAGATGTA CTTAAACAAA TGATGGAAGA AATTGAAATA TTCTATCAAA TTTTATATTC TTTGTTGTTT TACAAACAAA TACTGGTTGT CATTTTGAAA ACCCTCAGAT TTGTGGTATC AACAGTCATT TTGTTGACTT AGGTTTGTTT ATATGTGCAT GCG