Vienna Tile Information
VT ID VT060202
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202779
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 260202
Nearest Genes
Gene Nr FlyBase ID Distance
CG1641 FBgn0003411 656 bp
CG34143 FBgn0083979 8119 bp
Sequence Length 2366
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TGTTTGCAACAAAGTGTCACAATGTATGTACG
Right Primer CGGATCCCTGACTAGTCCAGCATTAGC
Template genomic
Sequence TGTTTGCAAC AAAGTGTCAC AATGTATGTA CGTTACTTAT ATATATGTAG AGTAGAGTTA TAGTGAGGGT AGATACACTA CACACTTGTA TATGGACACC GAGTGCCCGC TGCCCGATAA CCGCTAGCTG GCGGAGCAAC AAAGAGCATC AATAAACTTC GCCTTGTGTA GTTTTCAAAA TGAAAAATAA ATTGGAAAAT TGAAAAAGCA ATTCATCGCA TTAGGAACGT GCAGTGAATG GAGGTGGATT TTGTTGTGAT ACCACCCGCT CCACGAAGCG TCGCCGATGC CCATTGACAA TGCCGAAGCT TTTTATCGTC TTTGTGCCAG GTGCGTCCAC CAGACAATGG ACAAAGGGGC GGTGGGGCGG TGGGACGCAT CCTTGACCAG TACTCGGTCC GGCTCTCCAG TAACCCATCA GTGCTGTTCG CCAACTGGTA GTTTCATGTG AATACCTATG TAATGTGAGA GGAAGTCTGG AAAAAGGATT TAGATATTAG GTACTTTTTC ATTAATCAGC TGAAAAGTAG GCAGCAATAT TTTAACTATT TGTGAAGCAA TTTTACTTTT ATGTGTGATT GCGTGATAAA GATACTTTAC TTCAGTTACA TTCCTTTGGA TACTTTCCTT TGTATACATT CCTTTAGATA CTTTCCTTCA AACACTTTCC TTCAGATACG TTCCTTCAGA TTCGTTCCTT CAGATACTTT CCTTCAAATA CTTTCCTTCA GATACTCGTC TTTAGATACT TTCTTACAGA AAACGATATA CTGATCTGTT TTGCAGCGCC ATCTACTTCT GGTAATACTA CCCATTTTTA CCATAGCATC TGGATGGCCT TCATCACTCC CGGTTTTCTT TTCATTTCTG AAATTCTTCG ACTGCATTCA ACACAAACGA GCTGAGCTTT TATGGCCGAG CGATAAAATC AAATTGAAGT TCTTTTCCGG CACTTTACAA GAGGGAGTGA AAGAGAGAGC GTTGTGCGGG AAGAAAGAGA TGGGTGAAGT GGGTGCAAAG TTTCAACCAT TTAGTATTAT GACAAACAGT GGTGGACAGC ACATTAATAA CTGTACTCAA ATATTGAAAA TTATTTCAAA AGTTTTCCGT ATTTTAAAGT AGAAAAGTCT TTTTTTTAAT TTCATTTAAT ATACATATAT TTGTAGCTCA TAATATCGCC TTTAGGTAAC AAAATTAATG CTGTACCACA GTTAGGTACA CGAAGTACCT TTCCCCGCAC TGATGACGTT GAATCGCTGA ATTGTGTGCA CTTGAGTGAA CGAATAAGAG TGAGACGTGC GTAGTTAAGA AGCAGCAACA GAAAGTTGGA AAATCCAGGG AAATGGGGGG ATAGTGGGGA TTTAGCCGGA GGAAAACTGC AGCGATGAAA TCATTTGTAA CCTGGCACGT GAAAATGAAA TTTTTGAGCG AGCATCAGCT TGAAATTCGA TTGGCCATTG TGGCGAAATG CGTTTTATAC TCTCGTTTTT ACATTCCTAT TATTTGCTCC TCCATTCATT CTTAATGTTG TGCTATTAAA AAATATCTGT GAACAGTAGT AACGACTAAC TGATACCTAA AGAGTTGAAA AGATACGGCG TGAAATAGAA TAACTTTTTG GGGTAAAAAA CAATCAGAAG TATCTATATT TATCCTTCTC ATTACGCAGA CATCAAGATA TTATGAGAAA TTACTTAAAA AATATATGTA GTTATTAAAA TTATATTGTA TATATATATA CATAGTATAT ACCCTTGGCA AGCATTTAGT AAAGCTTCCA AGTTCAGTTC GCAGTTCTTA AATGAAAACA CCAACCAGAA AGTGGGGTGC TATTTGCAGT AGTAGCCCCA CTAAATTTAG CCACAATCTC TTACAGAAAC CTGCTCTTAA GGCCATTACT TCCATTGCAT TTGCTGCTTT TGGCAACGCA AATTGTTCGC AAGCCAAAAA AAAAAAGGGA AAAAAAGAAT GGAAAGGGGG AAAAACGTGA AACGGGGAAA GCGAAGTGCA ATCATGTCGG ATCAAATGAA CTGAACTTAA GCAAGTCGAA ATGGGTGCAT TGCATTGGCC CAATTCCGAT GGGATTACCT TCGGCCAGGC GAAGGAAACC CCAAGACTGC CGATGCGTTA AATGCAGAAT AAATGCATCC AAATTATGGG AAATTCTTGT AAAGTGAAAT TAACAAGTTA TCCTTGACTC CATATGATCG TGTGAACCTA TAACAAATAT TTGAATAAGA AAGCATTCGT TTTCAATATG ATTCTTAATT TTATTTAAAA ATTTAATAAT ATGCTTAGAT AAATACTAGA TATAGTCAAC AAAAAAAAAA AGTGGTATGG CTAATGCTGG ACTAGTCAGG GATCCG