Vienna Tile Information
VT ID VT046785
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202757
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 246785
Nearest Genes
Gene Nr FlyBase ID Distance
CG5610 FBgn0000036 31854 bp
Sequence Length 2263
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GACTCAAGATTTGCCCAAGCAAGGC
Right Primer aaaagGGAACAACAAGCCGAACCAA
Template genomic
Sequence GACTCAAGAT TTGCCCAAGC AAGGCAACTG TAACTTAAAA CTTTTATAAC TGAAAAACTG TATACTCAAA AGTTTGCTAT CCTCAGTTTT AGCCTTTTTC CTTGAACTCC GCAAAAGTTT TGCGCAAAAA AGATTTTATG TGTCAGCTGG AAAAGTTTTC CATAATTTGA TGTGCACATA GAAAATCGTA TGTGATGACT CAGATGGAGG GTGAAAAGAA TGTCCTCGGC CAATTACATT TATCAATTTG ATGGTTTGGC AACGAGGCTA AATTAATTAT GCTAATACGA TGTGTAAATT GTTTGTAATT TGTGCATTGA TTCCATTAAA GTGCGGCTCT CTTTCGACCC GAAATAAATC AAATCACATA CCGACGTCTG CATAATTCAG CACAAAACAC GTGTCAGTGA CCGCAGAGCA GAGCAAAAAC AGCAGAGAAA GAAAAAATAA TAATAATAAT ATTAGCTGGG AAGGCAACAT GACATATACA CAAAATGGCG ACAGGACAAC GAACAACCAA ACAACGAAAA TGGCAGGCAT AAACAACGAC AACGAAAATG AATGTCATTT CGAGGGCTAT TTATGCGCCT CTTAGTTGGC AGATTATTTC ATTTTCATTT CCATATGACC ATTTATATTT ATTTATTATT TATACTTTCC ACACACACGC ACGCACGCAT ACCCAATTTC TGGCCACAAT TTGGCTTGCT GCGGCTGTCA ACGCTGCGTA TGCGCAATTA TATTTGCTGA CTATATATTA ATATATACTG AATGTCAGCT GTGTGTGTTC GTTGTGTGTA AACTTTTTTG TTAGAGCAAT GCTCACCATA AAAACCAGAC GATGACGTGT CCTGCCCCCG AAAATAGCTC TCAAAGCCAT TAATGAAAAA TGTAAACTGC AAAACTTTCT CATGGAATTT TCGCTGGTTT TTTTTGTAGC GAGAGTTTTA GAAGGACTGC GATTGCTGGT CGACTGCACA GTGGAGTATG TATTCAGCAT GTGTTCATAT TAAACTTGCA TAATATTTTA CAAGTTTTCT ACTAAATCCC TTTTATTTCC ATTTCTATAA AATTATAGAT TCTGATTATA TAATTTCATC TTGGCTAACA ACCATTACGA TTGTGTAAAG TTCCCGTGTT ACACCACTGT TCACAATTTT AATTCCACAA ATGTTTCTTC TCCATTTTGG TTACACGGAG TTGGCAGTAT AATGAAGCCA AAAACTGACA TTGACTGCGG GCCACAATTT TAATTGCAAT CGGAAAAGGA CCAAAAAAAA CATACATAGA TAAAGAGAAG AGACCGGCTT ATTGCGGAAC GAGCTTGATT TCAGCACTTG GAAGACAAAT TCTCCGCTTT TTCGAAAGGG GGGATCTGTG AAATTAACGC TCGGTGCTTC ATCCTCATTT GCGGGGATTG AAGTCCACTA CGACCGGTAT TAAGTGCAGC AGAAGCAATA TGAGCAGCAG TTCAGGTTCC CCGCCAACAG CAGAACAAAT TGTTATGTAA TTGCCCGATG TATATATTTT TTGTATATAC ATATATAGTC TAGATACACA ATCCACTGCA ACACTGCCGC ACAAAAGCAA GCACCGCCAT CCTATTTTCC TGCTTGCTGC CATTTTATTA GCACTTGTTG GTCGCCGGAG GGGTGGTAGC ATATAAAAAT AATAAGTATC AAAAATAACT GACCAGCTCT ATGGCCGTAA AGAGAACGAG ACGGACATTG AATGCACTCG ACGTGTCCGA CGGCGGCTAT AATTTCAATC ACTTCCCCAG CAAACTGAAA CTGCAGCAGA AGCAGCCAAA ATGTGGCATT AAAAACACTC GTAAACGTTG CAGGATCACA GGACTCAGGG GTGCGGAAGA GCGGACTGGC GAGTAAGCCG AGCTGAGGGG TGGATTTCAG TGTATCCGCT TTCTCTGCTC AATTTTTTTT TTCTTTCGCT TTTTCACCCG TTTGAGTGCA GCCAGCGAAA TTGCAGCAAA TATTGAAAGA GAAACTATTT GTTAGCTAGC CGTCAATTTG TTCGTAATGA GCTGCGGCTG AGTCCAAAGT CCAGGCTCTT TGTTGTTGGC CAACTTTTGT TGTTGGTGCT TTTGCTGTTG CTGTGATGTG CCACAAATGA AAATGTCTTT CAGCGTGGTA AATATTTTAT GTCATTTCTG TGCACGTCTT TTGTGCGCTT GCTTGTAGTT GCCTGGGTGC TTCATTTTTG TTACTTTTCT TTTTTTGTTT GGTTCGGCTT GTTGTTCCCT TTT