Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT033452
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202743
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 233452
Nearest Genes
Gene Nr FlyBase ID Distance
Sequence Length 2322
ON Targets 0
OFF Targets 0
Viability sterile
Inserted Chromosome 3
Left Primer AGCCGTTGGGGTTCTTGCGA
Right Primer AAAGCGGGCGAAAAATAAACACACA
Template genomic
Sequence AGCCGTTGGG GTTCTTGCGA TCCTTGAAGA TCTCCTTGTA CAGCTCGATG TTGTTGTTGT TGATGGCGTC GTCGAACGTG ATGGTGATCA TCATGGGCAC ATCCTTGGCG GGCAGGTCGC CGGGAATCGA TGTACCATCC TCCGAGCAGA AGCAATCGGG CAGGACGCAC ACGGCGGGAT CGCAGGGCGG GGCACGGTTG GGATCGTTGT CGATATCTGT GGGCGGGGCA AAATGGTACA AATTATGGGG TTAGGACGAG GAAATCATAA GGTACATTAC GAAAGATTCC TCAAACTGAA GTGAATTGAA GGAGAAGTCT TGCATATAAA TGGGGTGTGT AAAGCACATT CTTAAAATAA GTAAGCAAGA GATATATGTA GGGATATAAC TAGAGATAAT CGATACCCTG TAAAATACAA ATTCATTACA ATAAACAGCC TGTCATCTTT TCCCATCAAA TAACCAATCA ACAATTGATA TTCTGCCTGC ATTCACCTGG CCGGCAAAAG TTCACTTAAC TTTTCATATA AATATTTAAG CAATTAGCCA ACGGTGAGGG GATAAAGCTT GGCGGGCAGG GGGTACGGGG TTGGTTCAAT GAACCGAAGT GGTCTGGAAA AGCAATCAAG AGAGGTGGGA AAACCGAAAC GCAAAGTGAA TGGAAAATGT CTGCACAATG CGAGTTTTTC ATCGGCATAT GTTTCTTTCA TTATTATTAT TATTGGGATT TTTCTTGGCT TTGTTTTGAG CAATTTTCAA GTGTTGTTAA TCAAGCGAAG CCGCTTTGAA ATGCAGATAG CGTTCGCTTA TTAGCCACAC CACACCCATC CCGAAAATAT GGCGCTCGAT TATCGGGCCA AATGCAAATG ATGGTCCACT CAATTACCAA TTGGTAAGCC TTGCACTTGC CGGCTCGTCA AACGGAATCA ATTGCGAAAG TTTCCAAAGA TATTAGCCGC AATTATTGTT GCCGCTGTCT CATTTGGCAT TTGGAATTGG TATTGGTATT GGCCAAAGTG AAATGGCAGG CACGGCATGT AAAGGCCAAA GCATTTTGTC CATCAAGTTT TTCACTCGTT TTTTTTTTTG CGTGTTTTCC ATTTTGCCGG CTTTGTCTCT TTGTTGACCT TTTTGCGCCG TGGCTCCGCT TTCATTCCCC TCCTTTCTGC CAATATTGGC CAATAATCTG TCGTTAAAGA CGGCTGTTAT GTCATCCCGG ACCGGTTCAG CAGCATTCAG CATTCAGCAT TCGGTATTCA CTCGGTATTC ACCAGATCCA CCGGCATTAT TGACTTTTTA GGGCTTTTGG CTTTTGCTCA TTTTATTTAT TTTTGCAGAG ATTGCCGCGG AGATTGCCGA ATGTATGTGA GCTGGCTCAT TATTGCCGAA GAGGAGCTTG CCAAGATTGG GATGAATTGT GGCCGAGAAA TAATTGTGGG GAATTTTGTT TTTGGCTAAA TTCGGTGGGA TCTTAACGTA CTTCCGAGAA TCGGTAATGT GTAGCTGAAT CTATTCATTA ATCAAAAGTG TTGATTGAAT TCTTGGAACA CTTCTTTTCG AATCGATTTG ATATTAGTTT ATCATTTTGC ACAAGTCATT CTCATTTGTT GCCAATTCTC ATATGCACTT TTAATCTGAA GTTAGCTAAA AACATGGGAT TCTCTTGAAG AGAATACACA TGTGGTGGAG TTATAGGCTT TATGGCTATT GCCCAAGTAA AACTACACTA TTTGGCAACA TTTTTTCGGA GCACTTTCCT CGTTACTTTG TCGCTCTTTT TAAAACTACG ATGTATGACC AGTTAATCGC TCTTTTAATC GCCTGCCATT TGCTTCGCCT CCCGGAGACG TGAGCTTCCT CATTGGGCCC AAAGGCGAAG TGGTCTAAAC TTGGACTGGA GTTATTCAAT TGTTTGCGAT CGCGGGCATG GCTTTCTGCT CGGCTGGGCA TTTCAAAAGT CAGGCAGAAG TGCAAATTTT CGCATTTTAT AGATAGATAG ATAGATATAT ACATTACGGA TCGCAATCGC AGGTGGTGAA TCTAGCAGAA GCAGAAGCTA GTTAGCCAGA TTTATTTGGC ACTTAATTGG CTTGTTGAGG CAGCCTTTAT ATGCCAGGTT AGCCACTTGA GAAATGTCGT TCGTGCAAGA AGAACGAAGT GAGCGTAAAC TTATGGCACT CACTGTTTGG GCATGTTATT AGTATTTTTA TGAATTAGTT GCGATTTTGC GCGGTCTGCT GTATCAATCT TTGGTTACTT TTGTTATTAT AGTGTATTAT TATTTGGTGC TTATGACTGT GTGTTTATTT TTCGCCCGCT TT