Vienna Tile Information
VT ID VT000608
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202719
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200608
Nearest Genes
Gene Nr FlyBase ID Distance
CG5423 FBgn0041097 7190 bp
CG5397 FBgn0031327 7435 bp
Sequence Length 2166
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TTCTTTTGGCCGTTCTTTTCGCGTT
Right Primer CCGGGACTGGAATCCAAGAATCCTC
Template genomic
Sequence TTCTTTTGGC CGTTCTTTTC GCGTTAATGC TGTGATCAGC CCATTTATGG CTTATTTATG CGCGCTTTAA AAACAAAACC CTGTCAACTG TCAGTTGGCG TTCTGATTGA CAAGAGCCTT TTACCTGTTT CGGGTCAACC GTACTTCCTC CTTAAGTAAA CATATCGTAT TACGACCCCA TCCAGAGCTA TTTTCATAGG GGTTAGTTGC CGAAGAATAA CACTTAAAGA TGTGGGTGGT GGTTCTGGTA TTCCACCCCC GGGTGAACCA ATGACAATTT ATGCGTTTTT AAAGAGCTTC GTTCTATTTT CCACCCCTGG AAAATCTTGT TTATCTTTTC GTTTTTTTCA GTTAACGGTC GCTTGCATTT CGTGGGCGCC CTGAGAAAAT ATTATTCTTT AATTTCTGCG CTATTGCATT TACCTCCCTT TGCTGTTTTT GCACTTTTTG GTACCTTTGA TGCAGCCGAC TCGCTGGCAG CCAAAAGGCA TAAATTCACA AGGGTAAGGA TGGAGACAGA TTTACCTTCC GAAAGTTCTC CTCATCTTTC TGGCCAAAAA CTTTGCAATT GGTTCCTACT CCTTTGCATC TCGTTTTCTT TTCTCCTCTC GATTCTTGCG AATCGCATCG CTTACAGAAA TCGTTGCACA AAGTTTGGGG CGCCACACAA CTAACTTTGA TGCATAAACT TCTGCCTTGC CAGCCGTGGA ATGAATGGAA TATTTTCCTC TCTACTTTTC CCCGCTTTTT TTCTCTGGCA TCTCAAGCTG TTTAATTGTC AGGCGAATTT CGCCTGGTTC ATTGAATTCA AAGTAAACTT TGTGGGCGAC TGCGGTGGCT AACAAAGAAT GGAAATTAAG TATATACCTG ACTGGAAATT ATATTGCTGA AAATTGGTGA GTACAAGAAC GGTTTCTAAT GCTTTTTACC TACCTTGATG AGTCTTTCCA CCAACACCAC TTTCATAATG CAGCTTTGCC TGAGATCCTG CTGAAAATGC ATTTCAGGAC CACTTACTGC GGATTCTGTC AGGACTAAGA CCCGGTAAGC CCAATGCTGA AAGTGGAGCC AACTTTACCA AGGAATCCTT GTAGCTCCGC GAGGACGTGT AAATATTTTG CCAAGTCTGT TCGGATGGGC ATTAATCATA TTAAACAGAG GCAGGCGTCA GACGACGGCG GGATTTTCTT TTGTTCCGCT TATGCGTGTG TGTGTGTGTG TGAGGGGGGG GGGGGGGGGT GGCGTGTGTA CTCGGCACAC AGTGCGTATG ATTATTACCA CTATTATTAA TATTATCATG TGCTCGCTCG TGGGCTCGAC TTGGCGCCCG GAGGTTGTTT TTACGGAATT CGTACGAGTT CCTGGCAAGG GGGCATCGTC ATTGCAATTA TTTACAAAAT CAGAGCACGT CCTGGCTCTG CTTTTATGCG ATTACGTGTG TGTGAGTGTG GTGTGTGCAC TAAAATGCCT CGAGCCGAAT CGCTTATTAC GCCACCGAAA GAGATAGCAG GCGGTTGGGA GCGGGACGGG GAGAGACACG GTTGTTGACA GGCTGCTTTT CGCAAATTTA AGGTAGCAGG AGCTCTTCGA GATCGGCCTG GCATATTTTT ATGTGTTCCC AACTTGGCTG CTGGTCGTAA ACATATATTT TTATTCGAGA GTATCCTGCG ATTTTTATCG GCTAAATAAG CCAGCCATTT GTTGGATTAG TTAATTGGAA AAGAACGTGT TTCTTTCAAA GCGAAGGCTG CTGCAACAAA CATAATCTAG AGTAGAAAAA CCATAGAACT CATTCAACAT TATTCATTTT AATATTTAGG ATCTTAAGAT AATTAAATTT ATTGGTAAAT ATAAACTGGC ACATAGATAA TGGACCATGC AAAGTACCAA GTTTATTGGC AGCAATTTCA TTAGAATGTA TTGTCACCCG CAGGAAATTT CAATTACACA TTGCAGGAGT GCTGAAACTT TTTGGAAACA ATTACGTCAA GTGCTGAAAA TTGTCAGCCA ACTCATTTTT AGACGATTGT ACGTAATAAG CCACTTTCCT TAATGACGAG ACGTTTTCAG ATCCTCAGAC GTAACTTTTT AATTTCCCAG TTTGCCCATC CGGCCACCAT TAGCATATAG ACAGTGGATT CGAGGATTCT TGGATTCCAG TCCCGG