Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000205
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202714
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200205
Nearest Genes
Gene Nr FlyBase ID Distance
CG4133 FBgn0031257 3064 bp
CG4297 FBgn0031258 5045 bp
Sequence Length 1958
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GGTCGCCAACATAGCCCCAAAAGT
Right Primer GTACAAGCGCCAAAGAGCAGGGAAG
Template genomic
Sequence GGTCGCCAAC ATAGCCCCAA AAGTTGGATT TTTACTTTTA GCCTGCAAAT TCTAGATTTG TGAACTGTGC TATTCTTTTT TAATTCTACA AAATAAATTG CAATATTTCT GTACAATAAA AAATAATGGT TATTTAATGG ACTTGCTTTA GTAATCATTC ATATTATCAA ATATTATCAG ATATCAGATT ATTATCAAAT ATTATTCCGT TCGTTACCTT TTTGCTAAAA AAAAAAAACC ATTGAAGCCA AAACTCACAA CTCACAGAAT AACATTTACA TAAAACATTT ATTTTTCTTT TTTGGATTTC GTATATCATT TCTTTTGTTT TGTTTGCTCA AAGACACTCA CATTGATAAA GTCACAAATC TTAAAGCTAA GGTACAGTGA AAACCTCCGA TTTAAAAGTA TAGAGTTACA GACATATATG TTATATTCAT TGTGGAATGT GTGGAGTGGC AAAGGATGGT ATGTATTTAC ATATTGCGCA ATAAATATTA TTGTTACTGC TAACATTTTT ACTCCATTTA GTGGGCTAGC TCTTGCACTT TGTATTTTGT TTGTACTAAA ATTAAGCGTA TTACTTAGTC GTAAAAGTTA CCAACGAATG AACATACATT TAGAAGCTTA GCTAGACATT ATAAATGTAT TAGTTTCAAA ATGTTTGGTC CTTTGGAATG TGTTACGAGA AAAAGACATC TAGGTGGTCT CGGTTATAGA ATAAGATAAC ATTTTTAGTT TAGTGTTGCT GTGGGCTAGG ATTCTAAGAC TAGACCAGCA TCCAAGTCTA TTTCATAGTT GGCATTGCCC TTGGAATATT GTTTTTCTCA TCCGCATTTT GCATATGTCG GGCGTTGAGA ATTCCTTAAG GCCACCATGC CAAATTCGAT AGCCGGTCTG GATTTGTGAT TGGCTATGCC CCAAAGTCGC CGTATGCGCA AAGCATCAAT TAGGGATGGG TCTTATGAAA CAGAAACCCT TCGATTTCCT TGTCGATACG GGAATTGGGC TCAATGGTTA GGTGTACGAA GCCAAAGCTT AACAATTTTC GTAATTCCCG TAATCTTAAA ATAAACACAA CAAATTGCTC TAGGAACCTA ACAAATAATT GCACTAAAAC AAAGTCTTCG GCTACTAACA GATCAAACAA TTGCAACAGA TGTATTTAGT AAATCTTTTA GTTTTTGGTC TAGGCTGCAT TTGGTGGCAA AAATTTAAGC TACAAGTGGG TGGCATTGGG CGGGTTTTTT ATGTCCGCCA ACTTACGCCA AGGCTAACAC GCAACTGGAA TCGCAAATAT TCCCCCCCGA TATATGTGTA TAAGTTATAT TGCGAATGTA TCTCAATCTG GGCCTGACCT TTGGCGAAAA GCATTTTAAA TTGGCTCGAC TCACTGAGCG AGTAAAACGC TGATACATTA GCCGATAAAG TATGTATGTA TCTGGTTAAT TGCACGCGAC TCGGACAGAA ACCCCAAAAC TCCCCGACTG ACCCCCGGTT AACCCTTTGT CTAACGCTGC TTACTCATGC TTTACCCATC GAGATTCGAA TTCGCGCATT CCAGATAAAC ACGACATTTT CCATGTAAAT ATTGCACAGA TATCTAAAAT ATATATGGTA CTCTAAAATA AGTATCGTAA AAGCTTAAAA ATTATGATTT TCCTAAAATG ACTATATTAC GCTACATTTC GTTTCCTTAA ATAAATCCAA ATGTTAAAAA AAGTCTTGAG ATTCTGTAAA GTGTAGCTGC TTTTGCATCC ATATCTTTAG TTTTCTTGTT TTGTGGTGTA TCTAAAGTGT ACGTGTGGTG TTTCTTTTAT TTACTTTCGA CTCGATCGCC TTTTTCGACG AGCCGAACAC ATCTGATCCT GTCCAGGGAC CAGAAATATC TTTGGTAGAA GCTGCAATCC TATTTGACTT TCCCGAGACG CTTCTTCCCT GCTCTTTGGC GCTTGTAC