Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000021
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202706
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200021
Nearest Genes
Gene Nr FlyBase ID Distance
CG31973 FBgn0051973 14511 bp
Sequence Length 2075
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CCGCCTGACTTTGCCTATTGGTATT
Right Primer TGAAACTGAACTGATTGCCTTGGGT
Template genomic
Sequence CCGCCTGACT TTGCCTATTG GTATTCAGTT AACTGCTTTA ACTAAGATAA GGAGAATTTA ATCGCTTATT ATACCTGCGG GTTCTAACCG CTTCTAAAAG AATGAATGCC GAAAAGGGTG AGAATTCGCA ACATACTGTG TTTTGGGCTG TTTTTTTTAT AGACTTAGTC ATATGCAACG GCCACCTGTA CCATGTCAGA AAGCAGACAC GAAAAAAAAA GACTTTGCTG GCACGCAGCA TATTTGCAGT TGAGTGCAAC AAGCCGTCCA GTATGTGCAC TCGTTATGAC TGGCAATATG ACTCTTGTGG CACACGTTAT TATCAACTGG GCAACTTTTT AAAATGGTAA TTGGCAGCTA ACTTTCAAAA TTTTTTCGAT ATATAGTGTA GTCGTAAGAG CTTTCCGTTT TCCTCTAGAC TGCTCTAAAC TTCAGGTGTG TAAGATGGCT AATCGAACCA ATGGCTGTTC TAAGGATTCC AAAATTATTT CTGGCCATAG TTTGCATTTG AGTTGCCCGA AAGTGAATGC TGGCCAAGCA TTGGCGACAA AGACCTCAAG TAAACGGACC GAAAGTGGGT CAGACAGAGA ATGTTGCATA ACCATCAAAT ACACAACTCG CTGGTGAACG AGACATTCGT GCTTGCTCCA CTGTGTGTGT AAGTATCTGA GATCTTTTTG CTAGAGGCCG TAGCTAGACC GACTGCAACG ACAGCGACAA CGCTACATTG TGGTACTAGC CTCACCACGC CCTCTTTAAA TTTGATCACT TTCGCTTCGT GTAACTGCAA CTACGATTTA TGTGCTATGC AATGTCCGTC GTTCATGTGT CGCATTAGCA ATAAGGCTAC CATATCTTGT GTGCTCTACA CTAGCTAGCC AACAACAATC CATACTGGAG ACGGAACGGA GACTTCAAAA TAAGTTTCCG AGCAGTGACT GTATCGAATC TATGTAGAGC ACGGATTGGG TGCTACCCCA GACGGCAAAG CTGGAATTGC ACCATAAATT GGAAACCGAT TTTGATGTTG TAAAACGCTT CGAGGGCGAA AAACTGCTAC TGCATGGTAG TCGCATTAAG TGCTACATAA CGGCAGTGTA AAAAGTCTTA AATAATTATA AATTGGGTAA TTCCACTAAA ATCCGATTCG CAACTCCATT TGAATGATGA CTATCTTGTT CCCCACAAGA AGCTAACCTC AACTCAGAAC CCGTGCCTGT AAAGAGGTCA TGGCCTATTC AATGCATTCA GCAAAAAAAA GGAAGCTAAA ATTATAAAAG GGTTACAACA AATTGAAAGT CGAGTAACCA TAAATTTTTG GCGAAACATC CAACCGAAAA GTAGTCAACA CTGAAGAAGA TTTACATCCT TTTAAATTTA TGTACATATA TTTATACCTA TGCGGCGTTG TTATGGCATT TGCAGTGCAG CGCTGCCGGT ATATGAATGC ATGCTCCAGC GGATAACGGT TCGTTTAACT TCTTCGCAGG TCAAGGTACC AAGTAGATAT GTACATATGT ATGTATGTAT ATCAGATTGG CTCAAAAACA GTGTTTATTG AGCAGCAACC AATTTACGAC TGGCATAGAG TCATACGGTC ATAAGACCGT TGTGGCAATA ACCATTTTCC TTTCTCTTTT AATTTAAATT AATTTGATAA GCACCAGGGC AACAGTAGAC TGCAACAATG ACCAGATCGG CCTGAACCAC TAATCCAAGC CACAGACAGG TCGTTTACAG CGAAAATACT CGATGATGCC GGAAATATGT GCATAGTGTT GCCAGGCAGT CGTCTAGTTT TTACATTGCT TGCTTAGTAT TTACAAAAGT ACCAGCAGTC AAATATTTTT ATTAATATAT CTACATATTA AATTTGACAT TTTTGTAGAT CGATTTGTCG CATCGATTAT TTTTTTTTAT TTTATTCTTT TTATTTTATT CTCAAGAACA ACATCATATT GCTGAATCTG GTAAATTAGT TCTTATTATA TTCTGAATTA GTTAACACCT TGGTAATGCT TAACAGTCTG AACCTTGGCG AGCTTCTTGA ACCCAAGGCA ATCAGTTCAG TTTCA