Vienna Tile Information
VT ID VT019841
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202680
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 219841
Nearest Genes
Gene Nr FlyBase ID Distance
CG13425 FBgn0015907 10194 bp
Sequence Length 2142
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer AGCCGAGTGGTACTCGTGTTTCGTG
Right Primer CCAAGCCAAATTGCGGATGGTAAAA
Template genomic
Sequence AGCCGAGTGG TACTCGTGTT TCGTGCTTAA ATATAGCCTT AGCCCATCTA TAGATCTCTC TGTATGTCCT GTATGCGCTA GCTGTACCCA TTTATAAATA AGTACATGAA CATTGTGATG TGTCCTTCCC CACAACCCGA AAGCAAAAAA AAAAAAAAAA GAATGTAAAA CGAAAAGTAT ATCAGGCACT AGGTGTCCCG ATCCGTATTT GTAGTAGTAT TGCAACCAAG CTTGCCGCAA TCTAACTAGC TCCGTCTCTT GATCTCGCTC TCCGGCTAAT CCTAATCCTA ATCGCATACT AATCCGCAAA CGCACCTCAA GTACCCCGAT TAACTATCCA TCCCAAAATG CACGGCCTAT GGTTATTTTC ACCGAAATCG GAATTAAGCC CAGAGCCAAG GGCCAATCCA TCCGCTGGCC TGAGATCATC CATTTGTCCA TATCGAAAAA TCCCAGCAAG CGTCTTGTGT GTCCTTGTGT GGTATTGTTG TACATGGCAA TAGGGACAGA ATCTCACTTG CTCGCTCGCC CTCTTGTTCT CTCTCTCTAT CTCACCGAAT CTCTCTGCCA AAGTTTGTTC CATGGACCCC AAAAATAAAC CAGAAAGAAA TAAAAAGAAC ACAATGTCTA GACCTTAAAT AATTTTCAAT TAATGTTCTA CTCTAATATG CGTTTCCCCT CACTTCTTTC TCTTTTTTCG CCAACACTCA CTATAAAAAA AAACAATTTC TATGCACGTT TAATCGCTCG AACAGAACCA TCCAAATATC GGCGGATATA GAGTCCACAT TGGAGATTAT CACCGAAATG CTGAAATACT TTGAGGAGGT AAGCCAACAT TGCCATTGCA TCTGTGCTCC AGATTGATAA CGCATCCCTT ATATATTCGT TCTTTCAACA GCGCGACGAG GACTTTGATG TGCGTCTACT TATACACCAG AGCTTGGCCG GCTGCGTCAT TGGCAAAGGT GGACAAAAGA TCAAGGAGAT CCGCGATGTG AGTAACCTTG ATTTCATCAA GTGTATTAGA TTACATAGAA TTGGGTTTTT AAGACCTCTA TCATGGTAAT AAGTTTATAT GAGTATATAT TATTAGCTAC GGTTGTATTT TATTGTTGTT TTCACATAGA ATGGCTTTAT AATTATAATG TTACAATTTT ATATCGATCG TGTAATTTTC ATACGAGCCA ATTATTACAT TGCGTTCCGA GCAGAACTTT GTTGTGGGAA AACGACAGCC AATGGACAGA CAACGGACAT ACGACTATTA CACGACCTGT CACATATTGA TGTCCCCGAT CCCAAGGCTC TTGCTGATTA CATATTTAGC TCAAGTATTT CCGCTATTTC TGATGTAATT CCCAGTTGTG CCTTCGCATG TGCGGCGTTC ACACGGCTCT ACACTATACT ATCCATGCCA TATAATGCCA GTGTCCTGCG GTCGGTCAAC TGACATAGCC AGCCAGCCAT GACAAATGAA GGCTAACTTA ATTGGGCCTA TTACGAGCGA ATAGTGGAAA CGAGAGGCGT AGGACATACA TACATGCGAA GGAGGGAGTA TAGCAGGTCA GGACGTGAGG AAGCCCGCAT TGTTAGTGGG AATTTGTGAC ATGTTTTTGA CGATCCCGAA CGTTTGCGGC GGCAGTCACG TGAAGCCGAA ACCCGTCAAC ATAACTTTGC GCTTGGTTAA ATCGAAAACT TTATGCGAGT TATGCTGCTG CGCCGTGGCC TGGCCTCCTA TAGATCCTCC GTTCTCCGAC CGCACAGGTC CTTGCACCGT GGCAACGACA GTAGAATGCA TTTCCATCAA TGAGCGTTTG GAATGGCGTT CAGTTGGGGA ATCTGTTGCT GACGTCTGTG CCAAGGCTTT CATAACGCAC TTGTCACTTT GGCAGCCGGC TCTTCACTGG CAAATTCCAA AGGGCAGGTG GGTTGTGAAA ATGCTTCCCG GACACGCCAA ACGCTTTTCA ATTGCGCAAT TCGCAATGTG AGAGGCTGGC TGCTGTGGCA TTGGGATGAT TGGGGTCGAT TCCGAAGTGT GGGCTGCGAT GGTGTGAATC AATTGGCGAA CTCTCGCCTT TTCTCGCACC TGCATGGGCG CTTTTTTGTT TTTTTTTTTT TACCATCCGC AATTTGGCTT GG