Vienna Tile Information
VT ID VT045584
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202632
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 245584
Nearest Genes
Gene Nr FlyBase ID Distance
CG42390 FBgn0259736 671 bp
Sequence Length 2117
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CGTGCCTGTCGCAATCAATTTCTG
Right Primer CCTTCTTCCCGTTCCCCTCTCGTTT
Template genomic
Sequence CGTGCCTGTC GCAATCAATT TCTGTCGCCT GTCGCCTGCA TTAATAGTTT CACTAATTTT GAAATTTATT AGATCCCCCC CCTCGCCAAA GTCTTACATA TCTGTTTTAT GTGTAGTAAA CAGTTTTTAT CACCTCCACG GGCAGTGGAA CGGAAAAGTC GGGCAGTTCA GAGAGCATAC TGTTTGGAAG ATCATCATCA GAGGAGCAGC TAAACAGACG GGCAGGCTGA AAATCCAAAA GGCTAGTAAA AATATTAACC CGTCCCTGGG CGACGGAAAA TCTATGGCCA GAATGTTTTA AATCCGCTGC CTGATCTGGC ATCAGTCAAT GTCAGTTGGC CCAGTGCCAG GTCGAGTGTG TGGGCGGCGA CAAACAAACA ATTGCCGGGC TAAAGAAATG TAAATAAATG TGGAGTATGG GGAATGTGCT CGAAGGTGTT GCATCTAAAG GCAAAGTAAC TTAAATCATG ACCACATATG AAACGGAGAG TACTTCACTT TCCATATTCT TCTTCCGACC AAGATGCGTG TCATGCTCGT CTAGAAAAAT CATTTTCAAG TGGATTTTGT ATTCAGTGTT TTGGTGCGAA CCATATTCAT ATTGCTGGCA ATGTACAGTG CGTTTCATAA AGCATTTAGC ATACATGGAA TATCTAAATA ATAAAAAATA TATGCGTCAA AAAGCGCATA TTCTAAACAA ATAGTTTTGA AATGTGTTTC TTTAATTTCA TAATCATCCA GCATATAAAA AATAAGTATC CATATAGACC CGAAACGCAC TGTACATATC AAAACTCTTA ATATGTATTG CCATATATTT CTCGATTGCT AACACATGTT CAAACGACGA CAAAGCATGC CAAATATTTA TGGCATATTT TTTGTTTGTG GCATTTTTTG TGTCATATTA CTTTAATTTC TATTAATTTT TACCTCCTCC GTCGCGATAG AGACGCTCGC CAGAAACATA AATATGTTAA CACATTTTAT TTTAAAAGAA TTCTTTAATG GATTTTTATT GACTGAGCTT TTTGGGCCTA TGGGTTGGGG CATTGGCATT GGCCAAGTGC AAAATTTATT ATACATTTAT CATTTATGTA TCTTTTATTT TTGCGTTTCT GTTTTGCTTC ACGTTAAAAA TGTTTATAAT TTTGTTTGCT TTGGATTTCT GAACTTGTGC AACAATTGGC AAGAAATATA AAATGTAAAT TCAACAATGA TATAAAGTCT ATGCCATCTG GTTGAAGGCT GTAAACTTGA ACGACTTATG AAGTGGGTCA GTGTTTTTTC TAACAAAAAA ACAAAAAAAA AAAAAAATAG AGGAAATAAG TATATTTATT GATTTGGAGT GATTTTGATC AGCCATATAG GAATTTCCAT TTCGTACCCA TTATACTCGA CTGCATCATT TCCGTTTCTG AATTTCGTGC CAAAAGTAAG AGCGTCATGC ACTTGACCAG ACCAGATCTT TCCAAATCCC CCTGCCAGCA CCTTTTCACA ATTCTAAAAA TGTTGATCAT TTGGAGGCGT TTGGTTTTTA TCTATATACA TTTAAAAAAA AATATCGGAA TTATGTGCAA ACTGCGCAGC TGTCTTTAAA TGCAAATTGT TCCACGAAAC ATTAATTTTA CTGTCGGCTT TCCTGGAATA AATCTCATCC ATTTTTTTAA TTAAAAATTG AGCTAAGCAT GCTTTTTATT CTGATTGTCT TCAAATTTGT TTAACTTTTA ATGAATTTTG ACCCATATTT CAAGTACTTT ATTACTAAAA AGCTAAAAAC ATTTAATTAC TCATTAAAGG TCATAGAAAA ATCAATTAAT TTGTATATCC AAACTGGATT ATCTATAAAT CTTCTGAAAC ATCAATTACA GTGATCTGGC GCCGGATTTT CATTTCAATT CCAAAGTGAC GTCAATGAGA GCCCTACGAG CGAAATTTTT CGAATAGATA TTTTTAGTTT TATTCCGCCG ATTTCGTTGC TTTGGAAAGT TGGCGGGTCT GTGTTTTATT TTATTGCTGC CTATAATTGG TTCGTTTATG TGCGGAATGG AAGAGAGCGT CCTGAACTTG AAATAGGGTA ATGAAACATG GTAAACGAGA GGGGAACGGG AAGAAGG