Vienna Tile Information
VT ID VT025717
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202588
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 225717
Nearest Genes
Gene Nr FlyBase ID Distance
CG7509 FBgn0035575 6873 bp
CG32239 FBgn0035574 103313 bp
Sequence Length 2307
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CAATTGAATCGAGCACGCATAACGC
Right Primer TCAGGGAAGCCTCGAACTAAACACCA
Template genomic
Sequence CAATTGAATC GAGCACGCAT AACGCTAGTT AGTGTTTACA TAATACGTAT ACCTATATCT ATTATCTATA CCAATACCAC TACTTATACT ATGCATAACC ATACGTACAC ACGAATACCC TGAACACAAT GCAATAAAAT ACCATACACT AATTAAACAC TTCAAATTGC GTAATAATTG AGAGGCTATT TGTTTCTGGA CTTGCGTCAT AAATCCTGCT TGCGGCATGT CTATTGAATC CACCTGGCGA GTCGAGGCGT TGCGAGGCGC CTCGATAAAT CTCACAGAGC TGAATTATTT TTAAATTTAG CACCCAAGAT TTATGGGGCA TAGGGAAATT ATGCAGGGCA TCGAAGCACG CACGTGGCCC AGACTAAAGC CCAAAACAAT CAGAATCACT GCCGAAAAGT GCTTGGCCCA AACCATAAAG AATGGTAAAT ATTTTCGGTA TTACAAAAGC AACCGTAAAG AGTGTGCGAC GGAGTTGATT AAACCATTTT AAACCCATGA ACTCATATTT GGCCAACAAT AAAAACACTC AAGTGGCAAG GGCTCCGGCT TTATTATTTG TTTAATTACA CAAACAACTG GGCAGATTAT TATGGTTAAA CACGAAACGG TAATTGTTAT GACCAGCAAT TGCTGCGACA ATTGTAATGG GCAAAAACGA ATATAAATAT GTGAACTGGC TTTGGTTGTT GAGCGAGCAC TGTGTATCTA TAACTGCGGT AACCGCTGGG TTAGAGCCTA ATCTATTGAT ATATTTTGCT AATGGATTTT CGAATTATAT TCAGTATTCA TACACGTAAA AAAATGAATA TATTTAAATT TAATTACTGC TTTATGGTGT TGTGAAAAAT AGCCATGCCA ACAATCAGAT ACTAAGATAA ATAGCTATGC ATTCTAACTT CAAACTTCAA GCTCCTTTTC GTTTAGTGTA GCACACATTT CTGGGCAGTG CAAAGTTCTT GTTATTAACT TTTCATTACT TTATTAGGGC AAAGAATTTC ATTATAACCA CAGCTATCTA GATTCCAATT CCAGGCATTC AACATGCCAA ATGTTTAATA GAAACACTCG AACTCGTCCA TTTTCCCTTT TCCCTGTGGT TAACCCACAT AAACAACAAC ACTGCGGACA CGTTGATATT AGTTCGGTTG AGGCAATGGG AAAATTATTT CCAGACTCGC CTGCGGCGCA TCAAAGCCTT TGATGGCTTC CGTTGTAAAT TATACTAATA CGCCACGTAA ACAAGTTCCA AATCCTTAAA GCTCCGCAAG AAGGCAAAAC TAGGGAAAAT TGAAAAATGA CGGTCTCAGG AAAATATTGT AGCCACTGCC TGGAAAAGCA ACAGCAAAAG CAAAGCCAAA GGGAAACTGC ATGCTGAGCG CAATTATGCT GGACAAACAT TTACCAGTCA GGCGAAGCAC CCACGACTGA TGCACAGAGA AAAAATTTGG CGACCTGATA AATAATCAAT ATTTTATGAA AATTTATAAG GAAATTAGGC ATTAATTATT GTACAAGAAA ATATCTAGAC GCATTCGTGT CTCACATTTT CATAGCTTGG ATGTTTGGTA CTAAAGTGTT GTAAAAAATG TTCAAACATT TGTTTTACTT CGAAAGTAAT TTCTCTCAGT GCCCCGCAAA CGACTGGTGG CAGGTGGAAA TGGGCTTGGA GGTCGGTACT TAGCATGCAC CTTGGCACAC ACACTCCAAG CCCATCCGAT GGCACTACTT TCAGTGTTCA GCTTCGCTGC TTGCCAAACA CAGACAGAGT CAGAGTCAGA GACTCGTGGA TTCGAAGGTT CGAGGGTTCC AGGGATCAGG GATTCAGGGA TGCAGGGACT ATGGCCCAAG TCAGCTGGAG ATGTTGACTA GGTCGTGAAC GTGTTATAAC AATAGGGTGT CGCGATGGGA GGTATGGATG CTGCACCAAC CAGCGACTAA CACTAACGAG CAGTTAAACA AGCTTAAGAT TTGCCGACGC AAATAAAAAC ACAGCCGGAG AACTGGTGTG GCCGGGCCAC CCAGTCGAGC CTCCCAGCCC GGCAAGGCCA CCGCCAATCC CGCCCAGAAA TTGCTGCCAA GCGGAACAGA GCGGAGCGGA AGTAAGGATC GGCTTGCAAT AACATAACCA AGGCACGTAG CACAAACAAG GTACATTATA TTGTATAAGC AGACTTCATT ACGGTATTTA AACAGAATAT CCACAAATTC TGACAGCCCA ACTGGGCACC GTGGATCGAA AGCCCAAAAT TAAAGCAGGA TATTCAGTAT TTGGTGTTTA GTTCGAGGCT TCCCTGA