Vienna Tile Information
VT ID VT010260
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202573
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 210260
Nearest Genes
Gene Nr FlyBase ID Distance
CG13968 FBgn0032840 15506 bp
Sequence Length 2110
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer ACTGGGTCGACATATGGGTCGTTTT
Right Primer CGGAAAATCGGTGACCAAAATTCAA
Template genomic
Sequence ACTGGGTCGA CATATGGGTC GTTTTAAAAG ATTTTTTTTC TTTTATAGAG CTTCAAAATA ATTTAGATAC TACTTAGGTA AATTAAATTA ATAATCATAT TCCGATCAGC TCACTGACTT CAAAGAAATT TGAAGGGCTA AGGCACCAAA CGATCTTTGT TCTTTGTCTT TAGTTCCAGA TAATTAAAGC CAGATTTAAG CAAAATTTTC CCAGTTAGCA AACGGTATGG TAATATAAAC GGGCAGTGCA CAAAGCAACG AACATTTGGC ATAGAATTTT TATGGATTCA GCATGTGACC TCCTTGGTGA GTCGTCAAAA CCGTTTTCTT GGCCCACAAA CAACCTTAAA GTTAAACAGA ATCGTGCCCT TTAGACAGTT GGCACCATAA ATTGATTAAG CCAAAGTGGG TGGAACAGTC GAATGGCTGG TAAGCTGCAT ATTAACATCA TAACAGGGCC AAACAGCAAA TCATAGAAAA CGCAAAATGA CAAACACCTC GTGACTCTTT TGGGACTCAT AAGTGAGCAA AAAAAAAAAA GAGAAAAACA AAAACATAAA AAATACATTT GTGTCTGCGC AATGCTGAAT TTGTGTATGT TGCGTGCTAC ATGTGGTTTC AAGCACGTTC CCGACGACAT CAGCGAATAT GTATTTTTCT GGGACCTCTG GGAGCTGTTC CATTTCCGCA GAACGAAGTC CTTAGCCTGA AAAAATGCAA TGATTTTCAC TTGTACATAA TTCAGAAAGT CGAATTAAAG GTTAAGTCGA ACGGAAACGG AAATCACTGA CTGACAGCTG CTCCCCTTCG ACGACTTCAA TTGTGTCGCC CCAGTGCTAA GTTATTTATG ATTGGACGGA TGTGAAAGTG AAATGAATTG AAAGAGTTCA TGCTAATTAG CCTGGCCACG GGAAAGTTGG GTGCGAACTG AACAACAATT TTAATTGCAT TGCTAAAGTC TTTCCGCCAC TACAAAAGTC AATTATGAAA AGCGTCTGAG TGCCAGATAG TCAACGGGTT TCAGCTTCAA ACTTTTCCAG CCCCTCGACA TTTCGGGGCC AAAGGTCACG TACAGATTTC GTTCATGGCA GTTGTTGAAA AGTATATTAA AAACAGGCAT AACCGAAAGA ACAATTAACC ATTTTTGCTT TAATTTTAAA TACATTCAAT TGACAGCTCT CAGTTATTGC TTAAGCACTG ATGAATGCAA ACAAAATACA AAAATGTTCA CAGAACTTGT AGCTTTATAA AACTATTCAA TTTGAAAACG TCTAGAATCT GGGCAACAGT TTTACTCACT TGCCTCAAAT TTTTGGACTG CCCTTAAAAT CCTTGGGGCA TGGTAAACAA AGTTTATGAT TTTGCCACCG TTTTATTGTT TTGTTCATGC AAATTGTTGG CGGCACTTAG TTTTGTTTAC AAATACTTGT GCATATTTTT AGGACTGTCG GGCTACCAGT TGACTAAACA ACAAAATCCA ATTTTTTCAA CAAGTTTGGT AAGCGGAAAA TAAAGCTTGA AAAATTGGGG TAACTGAATA TTCAACAAAA AATTAGGATT AGAATTAGAA TTAGGATTAT CCTTTAAATA AATAGAAGGA AAACTAAAAT ACATCCTTTC GATATTCATA CTTAGATTTA ATCAGCTTTA ATACAAGAGA ACGATAAGTC GACTTCATCG ACTATCAGAT ACCTGTTAGT CAGAATATGG AAACAACTAT TTTCCACATT GCCGTTCCAA TAAAAGTGGG CCTAAGATGG AAAAAAAACA AAAAAAACTC AAACCTGCGT CTGTGTGCCT TTGACTAAAG GTACTAAACT AAACTATTAG TACTGACTAA ATACTAAATA TCCGAATTTT AGCTTTTATA GTTAATACGG ACAAACGGAT GCACAAATGA ATGGAAGGAC AAACGGACAT GGCCAGATCG ACGCGGTTAT TGATCCTGAT CAGGACCTCA AATACTTTAC AGCTTCGTTC AGAACGTAAC ATTTCATTCA ACGATTCAAC TTCACCCGTT TACTTAACTA CTAAAGGGTA TACAAAATAT CAGAGGAAAA CTTTAGGGAA CAGCACCTTG ATTAATTGAA TTTTGGTCAC CGATTTTCCG