Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000131
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202570
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200131
Nearest Genes
Gene Nr FlyBase ID Distance
CG11592 FBgn0025686 1540 bp
CG3625 FBgn0031245 3631 bp
Sequence Length 2164
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GCGAAAGTTCTCCATATAAGATCTTCAAAAAGC
Right Primer CATAGAAACCTGATTCGAAAGCACCAA
Template genomic
Sequence GCGAAAGTTC TCCATATAAG ATCTTCAAAA AGCTCTAACT TTTATACACT GGAGACCTTG ACAAATCCTC TTCATCACTC AAGAAAAGCC CATGATTCTA ACTACTGTCC TATTCATTTT CTCTGTGTAT CTTAATAGAT GCGTGCGTAC AAGTAACAAT CGGAGTGAAC TTTAAACCAC GCTGCGTTCG TGATTCTAAT GGGAGATGGA TATTACCGCA TCCAGGAACG TTAGGTATTT GAATTTGCCC CCCCAGGGAT GATGGATCCT CATCTCTGGC TCGCTGGTGG GGAACTGCAC GTAGTTGTAG TCGTAATAGA TGCCGTAGCC AAATTGCACG ACTGCCGTCA GGTGGAGCAG GGTCCTCAGA GCCCCGTAGA CGCCCTGGTA CACGGAGTTG CCTCGCACGG ATGCCATTTT CCTGCTGCAG CTGCTCTGCT CTCGATTGAT TTTTCACGGC ACCAAAACAC AAACAAACCG GTCTGGTCTG TCGCTCCGAA AGTACTACTG CTTGCGAGTC GGAACCACCC CAAAAAAAGG GGCGAGCGGT GGAACAGTGT GCCCGAGCCG AAGCAGGGCC GCAATACCAG GTGTTCGGAT ATACACATAT ATGTATGTAC CCCCTTGTAG GGTTGTAAGC TACATCGAGA TTTAATATGA GCTAAAGTTT TAACATTTTG ATTGTGGGCT GAATACATCT GTGAAGATGT GGATTCATTT TAAATTGTGA CTAGCTTTGT TGAATTTGTA TGAATTTTTT GTTTTTAATT TATAAATTCG TGATGTAATT TTATGAAAAT ATTATTTTCT TCAAAACCAT TCAGAAATTG ATGTTGAAGT CAATTCTTTG ACGATAATCA TGAACGAAAT CTAAAATATT CACTCTCGTC TACCGTATGA AGCCACATAT CATTCAGGTT GTATCAAAAT ACATTGTTCT AGGCCAAAGG TATCTTTACT GACTACAAGC GATTAGATTT GAGTGTATGG GATCGAACTA GAACATCAGA CCATTACAAA TCAAAAACCA GTTATGCATC GCCTTCGTTT AACCGGTGTA GAGATTTTCG ATATGAACGC ATCGGCTTAC CGCACAAATA AAAGTTAGGA ACTTAAATTT TCCGCCGAAG GGCACCGTGT TGGGCATGTC GAGTGTGTGG AAGATGTACA CGCCATAGTT GAACTGCAGC ACGGCTGTAA AATGGAGGAG CAACTGCACC GCCTTGTTAA AACCCGGCGA AGTGGAACCT TTGCTAGTCG ATTTTGACTT GGGCTTGGCC ATGTTGAATC TCCTGGTGCC AGATATGTAC TGATTGTGGA GTAGCCAGAG TCCAGTCACT AGCAGCAAGG AATATACGAT TGCATACAGT AGTCACTCAC TAAGCACACC TCCAAACAAT CGTGAAACTC TTCAAAGTAT TGCTACAACA TGCTCGACTG TTCACTGTAT GTATTTTCGC TTTCGCTTTG AAACTGATAA GGTGCGCTTA TCACCCGCAC TCTCAATCGC CGTAGTACAA AGTATTTCCA CTTCAGAATG AATTGGCAGA AGCTAAAATG AAATCCGAAA GCGGTCGCTT AATCCGCATC GGTACGCCTC CGTCCCACGT CCCTAGATCC GTGCATATCT ACGGATTCAT ATCCTATGGC AACTGGGGGA GGCACGTGCC TTCCCAAGCG TGTCTATGAA TAGATACGGA TACACATGAG CCACATTTAT GAGCCGGGGG ACAAAGGCTT CTGGAAATAT CTTCGCAGCT AATGGCAACT ATCGTTTCCC GGTCCCATCA CCACCAATCC ACCCCCTGTG AAGGTCAAGG AACAAGGCCA TCGCGACAAA AGGCACCGCT AACTGAATTA CCTGGTAAAA TTATCAGGTG CTCTCTTGGT TCTTTGCCCT TTCGTTACAC GCGATGCATC GATTGTGCGT TAGTAATTGA TTCACTGAAC AATAATATCC GAAAATATTC ACGCAGATCC GCCTACAACT TGTAAATAGA GTTAATTACT GGACCATCTG CGCCCAGGAA CATTTATAAT GTAATCATAA CAAATACTTT AATAAGCAGA TCTATTAATA TACATATATA GAACACACAA TCTTAAAATT GTACATCAGA TTATACGTGA TGCTCCATTG GTGCTTTCGA ATCAGGTTTC TATG