Vienna Tile Information
VT ID VT047848
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202568
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 247848
Nearest Genes
Gene Nr FlyBase ID Distance
CG6496 FBgn0023178 0 bp
CG14237 FBgn0039428 0 bp
Sequence Length 834
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CCAGAAGCACAAGGGCGACAAGG
Right Primer TTGCTCGGATGAACTACCACTTCGG
Template genomic
Sequence CCAGAAGCAC AAGGGCGACA AGGTACGTGT AGCGAGCCAT TAGTCCGAGG AGCTGGAAGG ATGGCCAGGA GCAGGAACTG AGCACGGAAC ACCTGCAGCA GGAGACTTGC GAATGAACGT CGGTTGGCGC ATCCTCGACT TATATAGCAA CCTGGACTGG ATAACCCACT GCGGGAGACC GCCCGACCAC GCAACCCAAG AGCGTCAGTA TCGGTGTCAT CCGCAGGACC AATACATGTC ATCCGCAGGC AGCGGCGGTC CTTTAGCCCA GGCAAATACG GAGTCGAGTT GGAGCCACGC AAATATTTGG TTATGCAGTG TTTTATGTGC CAACATGCAG GCACCAAATC CCATTCAAGT CCAGCGATAT TTGTACGGGA AGGCAGCTCA CTGGCGACTC CATGTGGCAC TCAAAAAAAA GGAGGATACC CAATTTAGGC ACTTCTTTAA ACCAACTTAT TTATTGGATT TAAATAATAT ACGATTGCAG ACAAAATTGC TGACCTTCCA TTAAAACGAA CCTTATTTGT GAATAATATT TTGCTCAATT CGTTTTCTCT CTGTGTAATT GTGTGATTAA TTTTAGAACG AAGCTCGTAA AAATACCAAT CTTAAATATA TATAAAACTT AATAGCTAGC TCGGCAGTTG GGCCGTTTTG CGAAATTCCA GCTTGTTCCT TTGTTTGATC ACCAAACTGT GTAAATATGG CCAAAAAATT TCGCGCGGAC GTAATTGGCG AGAGCAAAAT GCAAATATTT GCTGAGAAAT TCCGCCAATT GTCTTGGTCA CATATAAAAC TCCCAGCCTC CGAAGTGGTA GTTCATCCGA GCAA