Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT041025
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202564
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 241025
Nearest Genes
Gene Nr FlyBase ID Distance
CG18290 FBgn0000046 2017 bp
CG9764 FBgn0004049 6032 bp
Sequence Length 951
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CGCTGAAGGAGGAGTTGAGGAGACA
Right Primer GCATACAGCAACGATGTTGAAGCATTT
Template genomic
Sequence CGCTGAAGGA GGAGTTGAGG AGACACAAGA ATGCAAAATT TTACAGTTTT AAAAATAAAT TATACTAGCA TCCTCTATAA ATTAAATCTA AATTTTAAAC GAAACGTATC TTTTATTCGC TGCAAGCGGC ATGCTATGCG ATTATTTTTA GCGACGCACA GGAAATTACG AAATTTTGCA CGCCCACTGC AAAGAGCGAA ATCTGGAGGT GGATCTCCTC GACTGGGGTG CACATACATA TGTACATATG TGGCTGGGGA TGAGCACGGT AATCCCAGCA TAGACGCCTC CAAGACAGTC CATTTTTGCC CATTGCCAGT CGGTGCAGGA GCTGCCCCCC TCGTCGTGGA TCTAAAAATA CAGACCAAAG GAAACAACAA AAGCGGCAAA TCAACATGCC GAAGTATTAA CAAATGTCTT CTAAGACTAC AGTCAACCCA CAGTAGATTG AACAAATATG TGACTTTGAA TGTCAGAATA TCAACTTTAA AGGGATTCGA AAATATATAT TTTTAAAACT AAACTAATTA GGAATACAAG AGCTCGCTGA AAACAGTCTT CGTTCAAGAC CTAGTTAAGT ATATTTTAGG TATGTTCCAC TGTAACAATG TGTGAGATGG CCGTTTTTTT GGAGTTAACA TAGCCGCTGG GAGAAGCGAC CGCCGGCTGT CTTTTAAATT GCAGTGCCAC GACCTCGGGG GCTGCAAAAA TATCTTGGAA TTTCAAGTAC ATTTGTGTGG CTGGTCCGGG ACGCTTGTAC TTGAAGATCG AGCAGACAGA CGACACCAGG CAGATGGGCC TCCTCGGGAC TCGGGATTCC TGGAATGGGG TGCCCAAATC GAAAATAGAC GAGATACGGG TAGGGTATGT TGTACTGTAT ACATGATGCA TAAATGCACT TTTTATTGAA TATTTTATAC ATTTAAATGC TTCAACATCG TTGCTGTATG C