Vienna Tile Information
VT ID VT037875
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202555
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 237875
Nearest Genes
Gene Nr FlyBase ID Distance
CG10101 FBgn0037501 1042 bp
Sequence Length 703
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TGGACCCTATGCAGCGTAAGACCTATCA
Right Primer CACCACCACACCTGGTTGCTCAAG
Template genomic
Sequence TGGACCCTAT GCAGCGTAAG ACCTATCAGC TGTTTCAACT CGTTGAGCGC ATGTTCAATC TCAGGTGGGT CCGTGAATCT AGAGCGGAAG TATGCTCTAA TTAACCGGTT TTCACTTAAC AAAAATAGTG AATTTGAACT CAAAAAGGGA TGGCTTAATT TTTTTACATT TAAACAATTT TAATGAATTC GCAATCTAAA ATACTATTAA AATACTAAAT ACTATATCTA AGCTCTTGAA TATCTAAGCC TTTTACTTTT TGAGCTGAAT GAAAACTTAT TCACAATAGA AATACTTCAT ACCAAATACA TAATAGGTTA ATAAAACTTA AAATGATTAT GATAAGCTCC ATTAATCAGA ATATTATCCC ATCTTTTTGC CAGTGCAGCT TGGCCATCAG CTTAACGGAT AAGTGGGGAG AGCTGCTGGA CAATGGCAGT TGGTCAGGTG TGATGGGTCA GGTGACGAGT CGCGAGGCGG ACTTTGCCGT GTGTCCCATT CGCTTTGTGC TGGACAGACA GCCCTACGTT CAGTACTCGG CGGTCCTGCA CACCCAGAAG TGAGTAAATC ACAGTGAACT TGACTTGCTC ACAGCCTCAC AGCGATTTCT CCTCCTCAGC ATCCACTTTC TCTTTCGGCA TCCACGTCGC AGCCACATCA AGAACATATT CTTCGAGCCC TTGAGCAACC AGGTGTGGTG GTG