Vienna Tile Information
VT ID VT028595
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202427
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 228595
Nearest Genes
Gene Nr FlyBase ID Distance
Sequence Length 2170
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GCATACATGGAAGAAGGCACAGGGA
Right Primer TGGTTCAATCGAGATAGTTTCAGGCTGC
Template genomic
Sequence GCATACATGG AAGAAGGCAC AGGGAAAAAA AAATAAAGTA GAGAAGGGTG AGGTGGTGCC AACTGCAATC ACGTTAATTA AAAAGGTGCA AATTGTGAAA GGCGCTCGGG GAATCCGAAA GCCAAATGTG CTGACAGCTG TTAATGAACG AGGTAAGTGC CAAAGGAATG GGCCATCATC ATCTCACTTG TTCGCCAGTC ACGTGCTCCA CTTGGTAATT AAACGTATCA TAATTTCTTA TGGCAAACAA TCTTACTCGT TTTCTTATTT TCCATATGTG AGCTGCTGTT TTCGGTACTC AACCGATGGG GAGCATTTTT AGCAAAATTC TCAGACCCAA AGGACTCGTG CATTTTTACA TGCATTTTAA TATTAACGCG ACGCGCGAAA TGAAAGGCGA CGCGGCGCAG ACAAAAAGGA TTTTTCCCCT CCAGGATCAG GCGCAGGCAT TCTACCAAAA AGGATGCGAC AACAGCGACG ACATTTGCTT TTGGCCATGG CTCAGTTTGG TCTGCAATTG CTAAATGCGG CTGTCTACGC CTTCGGGGGA GGGGGTGGTT GGGCGTATCA ATATGTGGAC TGGGCTTACA CTGGTTAGTG CATTAAATGA AGTCTCATTC CTGCAGACAA TTGATCACTA CAAAAAAAAA CATATATCTT GTTGCTTATA AACTTATATC TTATAGAAAA GTTCTTGTGA CAAACTTCAA ATTTTTTAAT TTTACTTATG TCTCACAGAT TAAAAATAAA TGCAAAATAT ATGATACAAG AAATGTAATG TAATGTTTAA ATAAATATAG TTATTTTCAA ATAATTTTCG TAGTCAATTT CAATAGTTAA GTTTAAAAAG TGTTTTCTTA AGAAGAAAAT CAGCCTAGAA AAATCCTTCT CCAAGTGTAC AAAAATGTGA AAAAATGTTT GGTTTTTTTT TTTTCGTTTG TAGTGCAATA GGAAAATATG AAATTTCATT TTGCCGACTG CCGCCGACGC GTTGCATGCA ACAATGGCGT CAAAGCAGCG GCAAATATGC ACGGACACCA GCGGCAAACG GCCAAGAGGA GTACAGATGG GACTTTAAAT GGTCGCCCAT ATGGGACAGC TCTAGAAAAA AAAAAGCAAT AGCCATGAAA TGGGATGAGC AGAGTGCATT AAAAAGTTGT AAATTCGAAT TATGATATTA AATTTTAGTC AAGTGGACGC GGGAGAGCTT CCAGTGAAAG CCAGATGCCA GCACGAAATG GAAACTTATA AAATCAAATG ATCGATCGTT AAATAGAAAA CATCGTGATG GAGATCAGTT CGAGCTTAGA GCGCCATAAA AATGATCGAG AACTATACAC AAGTTTAATA CAATGCACTA GGAATTGCGA ACTTTATTGA TCGTTAAGTG GTAATATGAG GTCAAATAGA AAACGCCATA GAAACAAAAG GTCTAGGAAA TGTTGTATGT TCGAAAGTAC ATGATAATTG AGTGATCATA AAAGATGCAT TTACCTTCGG CGAATGCTTC AAATAGTGCA TTTAATGATG TTCTAATAAA AAATCTACTG TATTGATTTG TAATTATGAA AAAACACCAG TCTCAGTATT TTTATGCCTT GGCAGGCTAT ATAAACTTTA TTACCCATTT AAGATGGCCT ATAATTATTA AGCCAACTCT GAAGGAGTTC TTTAATTGAA TAAGCAATGG GGCGCGGCTG GAAAGCAGGC TACTTTTGTA TCCTCTTACG ATGTGGAATT TTTTTTTAAT GCTGCTAAAG AGTGGGTAGT TGAGTCCGTA CAACTAAGTC AATTAATCTA AATCAATTGA TCATGCCTAA GGCTATGCAA ATTTGGTAAT AACTCAAAAC CAATTCCCCC ACATAACATT GGTTTCTGTT TACGATCACC GATTTTAATT GCAATTCTTG GACTTTTTAC GTTCCCTGCT GTGATTATTT TCATTTATCG AGCCAATAAT ATCATATGGA ACTTTTAAAA ATCTTTGACA GTTTTCGCAA CAATAAAATA AAAAACTAAC CAAAATACTT GCACTCAAAT TACGTTGATC GCGTATTTTG TAATTAACAT TTCATAAACT TGCCATCGAG ATAAGAGAAT TTTTCCATTA AGAATCAATT AAAGTGTACA AAAAAAAATA TTGCAGCCTG AAACTATCTC GATTGAACCA