Vienna Tile Information
VT ID VT022237
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202405
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 222237
Nearest Genes
Gene Nr FlyBase ID Distance
CG16778 FBgn0003715 5962 bp
Sequence Length 2214
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer tgaactcgactactggcattctctcatgttT
Right Primer GCGTCTGAAGCACAGAAGGCAGAAC
Template genomic
Sequence TGAACTCGAC TACTGGCATT CTCTCATGTT TTTTTTTTTT AGAATCTGTG TACATACATA TGTATTTGAG CGAGTTCTGT GCCTCTATTT GTGGGTGGTC GCTTATGCCA AGAAATTTTA ATTCTTCTTA TAGTCTCTTG GCAACGCGCC CTTAACGCTT TTTATGCGTT TTCCGACGTA ACGTGTGTGT ATCCTTGTTT GCTCATTAAA AGTTGGGGAA AAAGGTTTAC CACCTTCAGA GTTCTTTGTT TTCTGTCTGG TTTTTATTTT CTTTTTTTTG GGTTTTTAAA TTTTTCTGCT TTTCCGGTTT TTATAAGCAG GGTGCTTCAA TCACTAATGA AATTCCGATC GCAAACATTT CTTCAAAAGA TTATAATAAT TGTTGCATTC TTATCGATTT ATGAAAGATT TTGCATTTTG GATAACTTAA AATATACTCA AACAGTGGTA ATTGTTTTTT AAAACAAAAA TTAGGTACAC GTTAAGCGTG ATATAATAGT GTGTTAATGT CATTTCTTAT ATCTTCTTAT ATCTTGACAG ATATATTTTC TATCGCCCGC CATTGTGGAA ATCAAAAGTA CCGCAGCTGG GGCGGCAGTA ACACCATCGG CAATGGTTAC CAACAGAAGA AAAGAAAAGA ACCCAACGAA AATTCACAGC ATTTTATTCC ATACCCAAGT AATTACGCAT TCAAGCAGAA AAAGTTTATC TTTTGTCGAA AAATTGAAAA ATTGTAATTT CATAAAATGA GATTAAAACG CGAGTTCTCT GGCCGCTGTT AAAAGGCAAA GAAGCTGTAG AAGAGTTCAC TAGATGCCGT AAAGCCATGC AAACCACAAA ACCTCGGAAA TGGTTTGCCA AAACCAGAGG GCGGTTGGTG GGAAGGCCAG AAAAGCTGCC GGGAAGGGCT TAAATCTAGA AAGTTTACTT CCAAAATATT TTTAAGAAAA TTGCAAAACC GTCGAAGAAA ACGACGGGGA AGTCAGGGCT GATGGGGAGT GTCATGTCCG AACTAAGTAC AAGGACTGGA AAGCAAAATA ATAATGGCCT CCAACAGAGA ACAAAGTCCG TTAGAGAGAG GGTTTCAGAA AAGCCGATGA AGATGCTTAG ATGACAGTCT GGCAACGCCA CAGAGCATGT GCGTGTGCTG GGGTGTTGTC CTTCCAAACG CACTTTCAAC CCTTTTTGCG CTGGCGGGGA AAATTGCGTA AAGTGCAAAA TACAGTGCGT ACGTATACGA GTACTTACAC ACACACAATC AGCTTTTTAT ATTATGTACA CAGAAAATGT TTCATTTTAC GATATATATG TACCATGGCT TCCCTAGTAG ATGGTAACTG AAAGGGTTGT CCCAGCTTGA AAATGTTTCC CTTTGACAGT TATTGGATTT CAAAATGAAA TCCATTTGAT GGCAAACGAA GCTTTGATAT GTGGGTTAGC GTGGCCTTTA AAACACGGTA GTTGAATAAA TTAACAGGAG AAAACAAAAT AAAGAATATG GTATAAAATG AAAAATGTTT CGATATTTTT TTATTGTATT TTGACTTGTC AATTTCACTT GTCAACCAAA AACATTTTGG CCACACCCCT TCTAACGCTT CACCAATCAT CATCCCAAAA CTGTTTTGTT ATTTTTCCCC ATCTAAACTT GAATATTTTT AAAATTTTTT CTAATTTTGT TCCATCATAT CTATCGATGA AATTATGAAA TTTCGCGTTC GCATTCCCAC TAGCTTAGTA ACGGGTATCT AATAGTCGGG GATCTCGACT ATAGCATTCG CTCTTGTGTT TTACTGTGGA CAGTAAGTGG ATCCAAAAAA AGGATCGGGC TGGAAGGCAG CTGCATTGAT CAAACATCAC GTCGATGATA GTATTGAAAT GCACTGGCAA CTTGCATACA TATACTATGA GGCGGGAAAT GGGAAAGCTG AGAATAGATG CTGCCAGAGG AAATAACGGG TTAAATAAAA GACAATTTGA GAACGAAAAC GTAAAATTCA ATCACTTAAC AATCAAAAAT GTAAAGGTGC CAAATATTAG GCGGAACAAA GGGATAAATT AATCGCTTTC ATATGCAAAT TTAAGTGAAC TTCAGGAACA AAAAATATAA ATCTGATTTT GTTTTGGCAC GTAGCCTAGA GTCAGATAGA TGACGAGGCC TTTCAATGAA AGTGGCGCCC TCGAGAGCTG TTCTGCCTTC TGTGCTTCAG ACGC