Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000112
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202359
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200112
Nearest Genes
Gene Nr FlyBase ID Distance
CG3696 FBgn0086902 0 bp
CG11606 FBgn0022246 1130 bp
Sequence Length 447
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CCGTTTAACGCAAAATTCTAGCAGCA
Right Primer GTGGCGTAGCCTTTAACTAAAATACATCAGC
Template genomic
Sequence CCGTTTAACG CAAAATTCTA GCAGCAAATT TCAAGACAAC GCGACACACA CATCAAAGAC CTCCATTTTG TTTTGTTGTT GTACGCTAGA GCTGGGACGA AAATCAATGT TGCCAGAAGT CCCGGATACC CGCCAATCGA TGGTTCTTCT TTTTATGCCA TCGATATATT ATTTTAAATA TCGCTACTGA CATCACTAAT GTACAAATGA CAACAAACGG AAATATTATT TAACAAACAA CTTAAAATTT AACGATAATT AGCATAGTCA ATCGGGTATA GTTAGACATG TAGCTGCTGA AGTAAAACTG TCGACCTTTT CCTGGACCCA AACCACGTGC AGCCTAGACC CAAAACCATT ACGTTACGTT AGCCGGCTTT CGTCGTAAAA TCAAAACTAG CCAACTTATT AAAAAAGCTG ATGTATTTTA GTTAAAGGCT ACGCCAC