Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000255
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202314
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200255
Nearest Genes
Gene Nr FlyBase ID Distance
CG2914 FBgn0005660 0 bp
Sequence Length 659
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TGATGATTGGGAGTTGCTTGTGGCT
Right Primer GCCAAGTGGGTCGGATCAGGG
Template genomic
Sequence TGATGATTGG GAGTTGCTTG TGGCTCTGGC GGCTATTCTG TAGAATGGCC ATTAAGCTGG GATGTTCCTG CTCCCACTTC GAAAGTGCAA TATCAGCTAT TAGCTAAAGA CTTTTGGTAG CTTTACCGTT TCACTTTTCT TTGACATTAT TCGGTTGGCA TATAAATTCA TCTAATCTAT ATTTGCTTAT TGTTTGATTT TCACTAAGAT TTCATTATAC CAGCTTGATT TTTGGTAAGT GCACTTAATT ACACTTTATT GTTTATGTTT TTGGCGCCCT TTTGCACTAC TAGAATATTC ACTTCACTTT GGCCCTGTTT AATCATAATA TTCTAGGAAT CACACTTTCG CATTATTGCG TTTATTGGTA GCCTGCAACC GGTTGAAACG GATTTAGGAT GTGTGTTCGT CTGGCTGGAT GATTCACCCG AGATAGTCAG GGTATTTCAC CTGCTGACCG GACAAGTGGA GTCAGCGGCA GGCTTTCCAC GTGCCGCAAA TCGCGGAAAT CTTTCGCGGA AAGTTTGCGA TTGGAAACGT TTAATAACCG TTATTGCATC GACCGATTAC AGATCCGCCG ATCGGGTTAA GAGTAGCGCC GTATTCCACT CCAGATCGCC GATCTTCGAT CGCTCTGGCC CTGATCCGAC CCACTTGGC