Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000251
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202313
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200251
Nearest Genes
Gene Nr FlyBase ID Distance
CG11822 FBgn0031261 109 bp
Sequence Length 636
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TGCTAATGGGGATGCTTCTTATGGGG
Right Primer CGCTGGACTTCAAAGTGATCTGCGT
Template genomic
Sequence TGCTAATGGG GATGCTTCTT ATGGGGCTGA CTTCCGTGCC AGGCGCCACT GGTAAGTGTT TACGGCTCCG GAGTTGCATA AGCCGCTGAT AAGTGTGATC TCGAATCCCC TCCAGCCACC GCGGACCCCA AGAACGCCAA TGTCAAGGCC CTGGATCGCC TCCACGCCGG CCTGTTCACG AACTACGACA GCGATGTGCA GCCGGTGTTC CAAGGAACCC CCACGAACGT GTCCCTGGAA ATGGTGGTCA CCTACATAGA CATCGACGAG TTGAACGGCA AGCTGACCAC CCACTGCTGG CTGAATCTCG TAAGTCCAGT CCTCTCCTTC GTCCTCTCCT TCGTCTCGAG TAGCTGAGAA ACCAGATAAT TTCCGAGTTC CCTCAAGTTC ACAACTCTGA TAAGCAATTT TGGAAAGCGT GTTATCTGAA CTGAACTGAA GTGTTGTTTT GTTTTGTTTT TTTTTTTTTT TGAGAGAGTA CTATAAAGCT AATAAGTGTA GTGCATTTAT GAATATCTGA ATATCCAATC AACTAACCAG AAGCAATCGT GGTTTTCTAG CGATGGAGAG ACGAGGAGCG CGTGTGGCAA CCGTCACAAT ATGACAACAT CACGCAGATC ACTTTGAAGT CCAGCG