Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000025
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202311
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200025
Nearest Genes
Gene Nr FlyBase ID Distance
CG31973 FBgn0051973 3139 bp
Sequence Length 2058
ON Targets 0
OFF Targets 0
Viability sterile
Inserted Chromosome 3
Left Primer GGGGATCTTGATTATCGCGTTCTCTCTT
Right Primer TCGAAATTGTTGTCGGCACAGTACG
Template genomic
Sequence GGGGATCTTG ATTATCGCGT TCTCTCTTGT TCTTATTTAT TAAATATTAA AATGATTATA CAGAAATATA ATTTTTTATC CGGCCTATAT TTTATAAACT CATATGGATT AGTATTTAAA AAGACTACAG TTTTCCCACG CTAAATGGGG CTTACTGGAC CACACCCTAA GCAACTGAGA GTGCAGCAAC TCATAGGTGA CGGCAGCGTG ACCATGCAAA TTAGCCATTC GTGGCTTAAA TGTCAACTTT TTATAAAACA ATTGGAGCGG CCACTAGTAA GACAAGTGAA GCTAATTTAA TTATTCCCTT AAGAATAAGG ATTTGTGTTT GTATCGATTT CCCAGCTACT GTGTGAATGG TAAATTGTGT TGCTCATAGA AAATATAATA ATATAATATA ATATAATATA ATATATAATA ATATAATAAT ATAATTTATC TTTTGCTATT TTTAGTAAAA AATACTCCAT CAAAACTGCA CTGGTCTGAG CTTTGTCCCT ACTGCTGTAC TAACCCACCC ATAGTTAAAT TTTACTAGAA ATCAAATAAC AAACTTTTCC AAATAACGTC ATCAAACTAT CAAATTTATA TAAAACCTGT TCCTTTTTTT AAGAGGCTGC TAAGTGACAA TAAAAAATGT AATTGGTAGT GTGGCGAGTT CGCCAAAAGC AGTGCATTGA GCCGTGGTAC CCGAAAGTAA AATTGGTTAA AGAGACAAAA TCAACACAAA TAGTAAATAC CTAGCATTAT ACCTTTATAC CCTTACAATT ATTCACATAA TGCGCGGACG AATTAAAATG CACTGTTCTT ATGGTATTCG AATACCCGAC GGCAGCCTGC TAAGTATTAC GTTTAAAACC AAGCACTTAA TGATGCTCTA ACGAAACAGA TGAGTGCGAT TATGCAATCA CAGGGCACCG CTAATCGATA GGCTCACATA ATCGTACCGT GCCGGCCAAC ATTTTGTCAC TATGAGGCCG ACAACCGTTA TTAAAGCGAG CTCACTAATA CGTATTGGAG TCATATTGGG TTTGGTGAAA GTGAAAGGTG AACAGCATAC CATTTTGCGG TGCCGTAAAA TATATTATAA ATGAAAAAGT TGCGTATCCG AGTGCTTAAC AGAGGAGAGC AGCTGACCTG CTGCAGTTTG CCCTTGAGAG CCTTTAGCGT CAATTCCACT TAAATTTACC AAGCAGTGGT CTACGAAACA AACACAAAAC ACAACAACAA AAACGGAATC CCAACGGCAA TCTCGTCAAG GTCGATGCAT TCAACATCTG CAAAATCCAG TTTATACCCA CAAAGGAGAC GAAAAAGCCT CGACTGACAT AAGCAAACCG TGTGCCGGAC CATCGATTGC CAAGCAAAAC AATCACAATT AACTTCTGTA AAAAAAAGAG CGAGCTAAGG AAATATTTGT GTTAGAAAAT CCTTCAAGTA TCAGTAAAAT CTTCAATCTT AATAAAAATT ATATGGACAT TGGAAGCTAG CTTCGACAAG CCGAATCATC TAAACCCTTC GAATAATCGA ATAAGAAAAA TGTTATGATC AAAAAGGTTT ATGCAGCAAA TAGCATTAAA ACTGTGAGAT CAGTTTGCGT AGAAATAGAC GAACGGACAC GGCTATATAG AGCCGGCCGT TGATACTGCT CAATTAATGT GGTCGTAGAT ATAGGATAGA AAGGCTATAC AAAATAAAAG TTTACAGCGG CTTTTTGCCG TAAAAGAAAG TTACTTTGCC GTAACAAGAT TGGTGTAAGA GGGTTAAGTG GAGCAGCTGC GTCGGGCCCC ATTTAATTTC ACGATACGGT GCATAGAGAC GTCAAGAGCT CTATTTACAT GTGCTACGGA TATGGACGTC GTCGGCTTAA CGCAATGTTT TAATAGATTG CCCATTTCGT AGCAAAAATA ATTTTCAACT GTAATGCGTA AGCATTTCAA GGTGAGTAGC GCCGTAAACA ACAAGCTTGT AAGGGCAGGC GCAGAAGCTA AGAAAAGTTG GGTGTTGCCG TTTGGTAGTC TATTGGTACT CCTCGTACTG TGCCGACAAC AATTTCGA