Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000022
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202310
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200022
Nearest Genes
Gene Nr FlyBase ID Distance
CG31973 FBgn0051973 13101 bp
Sequence Length 2089
ON Targets 0
OFF Targets 0
Viability lethal
Inserted Chromosome 3
Left Primer CCTATGCGGCGTTGTTATGGCATTT
Right Primer TCATAAGCTGCACATAGGCGGTTGG
Template genomic
Sequence CCTATGCGGC GTTGTTATGG CATTTGCAGT GCAGCGCTGC CGGTATATGA ATGCATGCTC CAGCGGATAA CGGTTCGTTT AACTTCTTCG CAGGTCAAGG TACCAAGTAG ATATGTACAT ATGTATGTAT GTATATCAGA TTGGCTCAAA AACAGTGTTT ATTGAGCAGC AACCAATTTA CGACTGGCAT AGAGTCATAC GGTCATAAGA CCGTTGTGGC AATAACCATT TTCCTTTCTC TTTTAATTTA AATTAATTTG ATAAGCACCA GGGCAACAGT AGACTGCAAC AATGACCAGA TCGGCCTGAA CCACTAATCC AAGCCACAGA CAGGTCGTTT ACAGCGAAAA TACTCGATGA TGCCGGAAAT ATGTGCATAG TGTTGCCAGG CAGTCGTCTA GTTTTTACAT TGCTTGCTTA GTATTTACAA AAGTACCAGC AGTCAAATAT TTTTATTAAT ATATCTACAT ATTAAATTTG ACATTTTTGT AGATCGATTT GTCGCATCGA TTATTTTTTT TTATTTTATT CTTTTTATTT TATTCTCAAG AACAACATCA TATTGCTGAA TCTGGTAAAT TAGTTCTTAT TATATTCTGA ATTAGTTAAC ACCTTGGTAA TGCTTAACAG TCTGAACCTT GGCGAGCTTC TTGAACCCAA GGCAATCAGT TCAGTTTCAA CTTTTCAGAT GGGACTTCGA TTTCCGCTTA TTGTTTCACA CTTCCGCTTT TCACAAACAA TTGAAAAAAA AACCTTTATA GCTTATATGC ATTTTTAGCT TTCAAACAAT TGAAATGAGA GGATGATGCC AAATTTTACA TTGCTCCAGC TGCCTTTGTG GGCTGCGCTC TTATTGTCAC AGTGGCATTG GTGTGATGGT TCAAGCTACC AATGGCTTTC CGGTAGCCGA GATGCACTGA AAGTGAATAA TTCCTCCTAA TACATTTTTA AGCGCCATTA CTTATTTGTA ATTCAGTGCA CCCGGAAAAC ACCAACTGCA GACACTCATA ATATGGACAT CGTCGTCTGG ACATTAAAAT CGTCCGCATT AAACAAAATA AGTATGTTGA ATTTCACAAA CACAATACCT AATTGAATTC CGAGCGTATT TACTAGGGCA GAAGGCTGTT AAGAATTAGC CAGTATGTGT TAACCGTAAA ATAAGATATG AATATTGGGC TGTCGTAAAG CACATGTATT CTACTGCGAT CCAATGGGAT ATATTTTCGC CAGGAATGTT GGTGGGTATC TTTTTGCAAC CGTTAGCAAT AATCTTTCTG AATGATAATA CAGTTTGTTA TTAACATTCC TGGACCGCAG TTCCCGGGTT TAAGTAATCG GGTAGAAATG AATTACAATA TCAAATTCGC ACGGTCGCAT ACTCGGTCCG CAGCATACAG TTTGTACCTG GGAACTCCCC GTCTTTGGTC TAGGGCGTAT ATAGCAGGCG CATTGTTTAG CAGCGGTGTT ACTGATGGAA AACTCCATTT GCTTGTTTGA GAAATAAAAT GGTTTGTATG CATTCAAAAT TTAAATAAAA ATGAACGCTA TACGAACACG AAGTCCATCG TTGTGGCAAA CAAACTTAGT CAACAAATTA TAGCAACAAA ACCCAAGGAT AGCATTTGCA ATGATAGTAT TCCTAAGCTG GTGACTTGGG ATTACAATCT AAAAGTGAAC GTCGTGTCGG CTTATGTGTT GGTCTGGTCG AAAAAATTTT TTGGGTGTGT CACAAAAGCT ACAAAATTGT TGGGCTCAGT ACAAAAGAAC ATAAGAAACC TTTAAACTTG TGCACTAACA ACATATCGAA ATTCGGATAA CTTCAATGAT TTGTAGCATT TAGATAATTT TGCATCGCCA TAACTTTTAA GTTACATTCT GTATTGCGAT ACATTTAAAA CTATTTGTCT AGAACGTAAA GCCACAATTA CATTACTACA TCAGTGCTTA AAAGTCGGAC CAGAAACTAA TTCAGGGTCA CTTAACGCCC TGGCGTGTCT GCCAGCTGCT GCGGTCTATA AATGGCAGCT TCGCGACTGC TTGTTGCGCA AGAGAACTTA ACAACCAACC GCCTATGTGC AGCTTATGA