Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000020
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202309
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200020
Nearest Genes
Gene Nr FlyBase ID Distance
CG31973 FBgn0051973 15911 bp
Sequence Length 2125
ON Targets 0
OFF Targets 0
Viability lethal
Inserted Chromosome 3
Left Primer TCGTGCTCAAGGCGATAGTATATGTAAAACAC
Right Primer AGATCTCAGATACTTACACACACAGTGGAGCA
Template genomic
Sequence TCGTGCTCAA GGCGATAGTA TATGTAAAAC ACAATTTTTT TTAATATTAT ACTGGGTGAT GATACCCGGT GCGACTTAGA TGTGTCACTG CTGCCTGGCC CAAAATAGTA CGAGAAATAA GATGGCTTGA AAAAGCGGCA TTTCAACATC GCCTCTAAAG CCATTAAATT GGTAACCGCC AATAGCATGG CCAAATTTAG ACAAATGGCG CAAATCATTG CACTAATTGC CACCTCGTTT GGCAGCGTCA AATGGATCTT ATTTATGCCA TCCTCAATGA GCTGTTAGTC AACACTGCAG TTGGTAAAAG AGGTAGTTAG GTCAAATAAC ATTAAGCCTT TAAATAAATC TGTTCAATTA CGTTACGTGG ATAAAGTTGG AAGTCTTTTC AATATTTATT TTATTTCTTT CACTTCTAAT TACTTATAAG TTGGTTAATA ATATTAGTTT AGGTCAAGAT GAATGTTGAA ACTTTAATAA CGGTCTTTGT TATATTCAGT TATATAGTCA GGGCCTGCTT GAGTGCCTTA ATAAAATTTC CCTTTTTCGT GTTACGCGTT TGAACTTTTA ATTACACGTA GCTTGTTGTT AAAGACTTCC ATTTCACTGG GTCCGGTTCA AAATTAAACG CGCGCCGAGC ACACCCGCCA GATAAAAATA TAAATTACTC AGTGCAAAAG CGATCAATTC AATTGCTTGT TGCATTCCGA CATTACTTTG ATAATTAAAC ATAACCCATA TGACCACAAA CACAATATTT TCCTTTGCAG GCATACGTCA ATGTTAGTCC GTACTGATCA GCATTTTATT ATTGTGTTTC CGGTATATAA ATATCATTCA TGCTTTTTCT TCTCGGGTCA AACACATAAA CCCAAACAAA AAGATATGGG TTCTCAAATG TAAAGAAATC ATTTCGTGTT GTCAAAATAA ACCAATTTTG ACTTTACATT GCAGTAAAAT CTCTGATATA GGAGGCTTCA GTTGTCTTAG ATAGTAAGAA ATAAAAGTGA ATAGCAGCAG TGTGCCTAAA GAGAAACAAA ACAGGAAATA TCCACCTCTT TCTCTTGCCC CATGCCTCTT CTCCCGGGTA CTTTTATTTT CGTAGCTGTG GGCAACATTC AAATACTAAG CGAAGCTCCG GCATGAAGTG CTTATGGACT GTTATGCAAC TAGCCAATGG GCTTATGTTT CCACTCATAC TCGAACAATC GAAAATATAC TTTCTACTGT ATCTCAACAG TGGCTTAGTT TACCTCCCAA CAATTTTTTG GGGGAGAATG CTTCAGTTTT CAGTAAAAAG CTGTGTCGGC GGTTTTACGT ATATACTACA AGCATAGCTA AGTTTATTTG TTTCGAAGTG AAGAGAGAGC GGCCCGGTAG TAGGACACTT GTGTGGATAA TTTGAATTAT TGTCTACGTA TTAGAAACTG TCATTGTGAG TCTAGTTTTA CCGCCTGACT TTGCCTATTG GTATTCAGTT AACTGCTTTA ACTAAGATAA GGAGAATTTA ATCGCTTATT ATACCTGCGG GTTCTAACCG CTTCTAAAAG AATGAATGCC GAAAAGGGTG AGAATTCGCA ACATACTGTG TTTTGGGCTG TTTTTTTTAT AGACTTAGTC ATATGCAACG GCCACCTGTA CCATGTCAGA AAGCAGACAC GAAAAAAAAA GACTTTGCTG GCACGCAGCA TATTTGCAGT TGAGTGCAAC AAGCCGTCCA GTATGTGCAC TCGTTATGAC TGGCAATATG ACTCTTGTGG CACACGTTAT TATCAACTGG GCAACTTTTT AAAATGGTAA TTGGCAGCTA ACTTTCAAAA TTTTTTCGAT ATATAGTGTA GTCGTAAGAG CTTTCCGTTT TCCTCTAGAC TGCTCTAAAC TTCAGGTGTG TAAGATGGCT AATCGAACCA ATGGCTGTTC TAAGGATTCC AAAATTATTT CTGGCCATAG TTTGCATTTG AGTTGCCCGA AAGTGAATGC TGGCCAAGCA TTGGCGACAA AGACCTCAAG TAAACGGACC GAAAGTGGGT CAGACAGAGA ATGTTGCATA ACCATCAAAT ACACAACTCG CTGGTGAACG AGACATTCGT GCTTGCTCCA CTGTGTGTGT AAGTATCTGA GATCT