Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000018
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202308
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200018
Nearest Genes
Gene Nr FlyBase ID Distance
CG31973 FBgn0051973 19836 bp
Sequence Length 1416
ON Targets 0
OFF Targets 0
Viability lethal
Inserted Chromosome 3
Left Primer TTCCATTGCGTTCTCGCTCTTTAGC
Right Primer AGAATATACCTCCTCCCCCACCGGA
Template genomic
Sequence TTCCATTGCG TTCTCGCTCT TTAGCTGACG TATTTTGGAA GAGTATTTAC ACATCCTACC AATTGCCGGC GCACCATCGT TTAAGCGTTC TTGAGAACTG TATGAAATAT TTGAAGTCTC AGTAGAAACA GAAAGCGCGG TAGGGCTAGT GCGCTCAAAC ACTACGCTTG AACAATTTGA GTCGTTGCGA TTTTTTTCTT CTGAAACTTT CGTCGGCTGG GCACTAAGGT CGCGGCGTTT GCGTCGCCTA CTTTCATCAA GTCGGTTGTA GGACAGTTCG TGAGTATGGT CGTCCTGCAG GCTTTCGCTG TTCGTGTACA GTGTTTTTTC CAAAAGCGTA AAGGTTGTCC GGGTTTAAGT CGGAGTGTAG ATGTGTCGGT GTCGGGTGGT GCAAAAAGAT AGCGCAGTAT GCGTTGTATG AGAGAAAAGA GCATGTAACA TAATGAGTTG CTTGGAATTT TGCTGGCATC AAAAAGTAGT GTCATCGATT AGAAAGCAAC GATTGTGAGA TCTGAGCTAC TTGTGGCAGG AATAACAGCT TACCTATAGG CGGTTCCAAA AGCGTAAGAT CCGATTTTTC CAGTTTGAGG AATAGAATTA ATACTAGCTT GGTGAATAAT ACCATCGCGA TCGCGTTGAA CTTGACTAAC GGTACTGGGT TGGCCTCGAT ACACTCTCTG CTGACGGTCG GACTCCTCTT CTTCCACAGG CGGCAATGAT TCCTGCGCAT CAGCATACAG CTAAATTACA TAAAATATTT ACATTTTATT TCGGTTTTAA AAGTTCATTT GTGTGAAAAT TTTAAAATTA GAAATCACTA GATGGAAAGC TTACGTACCT ACCAGGAAAG TGTGTGAAGT CGACTACTAT GTACTATATA TACACGAAGA AACAAAAATC TGCTGTTCGA TATTAAGGAG TAATACAAAA ATCGAAGGGT ATCGTAAAAA CTAACGAGAA TGCATACCAA CACTTAATAG TTTACGAGAA AAAGCGGCGA AAGCGTAATA TTTGAAATAT TGAAATTGTG GTTATGGGTC TGTAAAAAGA GCGCATCGAT TGACACCTGA ATCATATAAT TATTCAAAAG ATATTGTTCT AATTTTGATT TTTTTTTAAA CATTCCCTCG CAAACATCGA TTTTTTTTTG TTTTTTAATT TAATCACTGC AAGGGTATAT AAACCTCGAC TTGCTTAGTT CTTATATTAT TTTTTTTTCA ATTATATTAT ATGAATTCGG AGAATTGAAA GAATGATCCC CCAAAATAAA TCCTCAGTTT GTCTTCGAAT TCATGTTCTT TTGAGTTACC TTTGCAATGT CCTCCTGGGA GTCGATCAGC GGTTTTGGTT GACCACGCGA CGTGATTACC GGGTTTGGTG ACACTCGCAG CTCCGGTGGG GGAGGAGGTA TATTCT