Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000016
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status suspicious
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202307
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200016
Nearest Genes
Gene Nr FlyBase ID Distance
CG31973 FBgn0051973 24434 bp
Sequence Length 596
ON Targets 0
OFF Targets 0
Viability lethal
Inserted Chromosome 3
Left Primer GCTGGCGTTGTTAGAGTGAGTGTGCT
Right Primer CCCTTAGAGCTTCCCGCCACTCC
Template genomic
Sequence GCTGGCGTTG TTAGAGTGAG TGTGCTCGAG TGGCTGGCTC GGGTATCCAG TTTTTGTATG GCCACATGTT CTGCCCTGAT AGATAAATGT ATTGTGGTTT GGTGTATACG TATTGGCTTG GTGGTTGTGT AAAAATTTTG ATGCATGTGT AGTGAGAATA TGAAGTTTTA CACTTGTTAG GGTTCTAACT AGTTTTGCGG GATACTTCTT ATTGCAGGAA CTTTTCATGC TTGCAAGGCT GACTGTTTTT CTGGGATTGA GTTTTTTCGT GGATGATCTC TTTTAAAATG CTTTTTAAAT TAACGAATGC CGTGGCTTCA AAGCATTTAA ATGGAATTAC TTACCTTTGA GGAGTACGTG TTGGATGATC GTACGCATTA TCCTGTTCAA TCTAAAATTA TGGGTAAACA TAAAATTCGT AGTATTTAAA TATATATATA GTTTGTGAAA AGAAACGGTA TTTAAAAGTT ACAATATGAG AAATACTAAT ATAGATTTTT CTGTACCTGG CTATTAATAT CCTCATCGTA GTCTGTATTG TACGCTGGCT GGTTTTCGTA AGAGGGGGGC TTCGGAGTGG CGGGAAGCTC TAAGGG