Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000015
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202306
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200015
Nearest Genes
Gene Nr FlyBase ID Distance
CG31973 FBgn0051973 25359 bp
Sequence Length 729
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer AGGAAAAGGTGTGGAGCTGGTCGTG
Right Primer CATCCACATTTCCTCCAACGACAACA
Template genomic
Sequence AGGAAAAGGT GTGGAGCTGG TCGTGGTCAT GTAAGATGTA CTGGAAGCTT TTGTGGTTGT TTTTGACTTG TCAGGAATAT GTTGTTTATA TGGCTTATTT GCATGCGCTT TCGAGCTGTT GAAGAGACGT GTATTGGAAT AAGTAATCAC ATAAGTGTTA GTAACTTATT TAAATACGTA TAGAGTCGCC TATTTGCCTA GCCTTTTGGT TCTCAGATTT TTTAATTAAT TTTGGTTTTT GGTTATCGTT TTCGGTTGGG CTGTAATCTG AGACAACTGC ATTTAACGGA TAGAAGCATG CTCATGCGTA CCTATATTTC GAATCACCTA AACGTTATCT TATGAATAGT CATGCAATAT ATGTGAGTAA ATAATCATAT TAGAAAGATA AACAAAAACA AAATTAAGTA ACAAAAGTGT CTAAACAGTC AGCATAGCTT TTGATCCCTG TCACGACGCA AAAAAGTGTG TAACTTTGCT GACGCTGTAT ATATCATTAC ATTGCTATAA GGGTGTAACT GTGTGATAGC CAAAATTTTA AGCTGCAAAT GGTTTGTAAA TATGATATAT TACAAGCTTC ATGAAAATCG GTTTATGACT GATCCGCGAT TACGTTGAAA GGCGACTGGC AGAGATACTT TTGTTCAGAT GTTTTTTCAG GTAGCGATTC CAATGAATAG GTAAAATACC TTGCAAGTTT TGTTGTTGTC GTTGGAGGAA ATGTGGATG