Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000007
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202305
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200007
Nearest Genes
Gene Nr FlyBase ID Distance
CG2671 FBgn0002121 1135 bp
Sequence Length 2208
ON Targets 0
OFF Targets 0
Viability lethal
Inserted Chromosome 3
Left Primer TTTACAGTTGACCAGCTTTGCGATTG
Right Primer CCTATGACTTCAAGAATGTAAAACCCTTTTTGTT
Template genomic
Sequence TTTACAGTTG ACCAGCTTTG CGATTGCATA CCGGTATCTG TTTATTCACA TATACACACA CAAATTGCGT GTTAGACAGA CAGCAAAATG ACGACTGTTA ACTGTTGGCG TGGCTGACTC ACCGACTACG CCTCTATGCT AAGAACATAC ATATTTGTGG ACACTTTATT TAAGAAGTTT GAAATATAAA TCAATTGCCT AATCAGTAAT ACTGTTGTTG AGCCCTTTAC CTTTATGTAT TTCCGTTTGT ACGGTTAAGG CGGTGGCCGA GTAATTTTTT GAACTATTTT ATTTGCTCAC CAACACGCAT AAGTTTGTAT GTATTCTTAT GTTGAGAAAC GCCCGCACTG TTCTTCACAT CGTTGCTTTA AATGAGAATA AATGAAATAA ACGTGTCAAC CAAGAACACA CAGATAATAA TACGACCGGT CAGAGCTTAA CCGTGTATCT GTTTTATAAA ACGTGAACAA TATTATTAGC CCAAAACGAT ATGCGCGTCA TTTTAACACA CACAAAGTCG CGATCGGTGG GTCTAGTGTG CCCGTGTATC TCTATCGAAA AAATCATATA TTTTTTAGAA GGTATATTTT CCATGACTGA CTGGAATGGG TGGAGAACAT CGCTTTGGGA GTGAAACTCC GCTATAAATT GTCATTTGTT TTTATAGCAA CCTTTTTGAT ATGGTCGCCA ACTTTTATAT AATTATAATA ATAATTTTTG TAATTAATCA CCGCTGTCGC ACGAAAAATT TAGGAAATGT GCCAACGAGC GGAATTTTTC GGAACGATCG ATGTTTTACC ATAACCTGCT ATATAAATTG TGAACCACAT TTTCAACACA AAACTAGATG TGCTTCATTT ATAACGCAAT GTCGTGATTT TGTGGGCAGT GTGACCATGT CCAATCTGCG TTCAAGTAAA ACCATATTTA GTGACACAAA CTTTCCATTA CAAAATACCA AACAACTTTA AATTTGTTGT TGCATCAAAC TTTTTCTTTC TATACATATA ATATTGCGGG TGTATTTGGA TTTCTAACGC AGTTACAGGC GAATAAACTC ATTTTCTTTT GACTTTAAAA TCTTATCAAT TTTACGCCGT CTATGACATA CTTATTTTGT ACCTGAAATA AGGGTGTTTG TGAAACCAAG CCACTTACCC AACCCATTAG GTACATAAAC GCAATCTTAT CAGCTCCCCC CTCTTTCTGG AGCTGGATGG CGATTACCTC TGACCTACTT TTATTTGTTG AATAACATGT TTATACTAAC ATAGGATAAA AAAAATTTCA TATACGTATA TTTATTAAAC TATTATGGTA ATAGGGAAAC ATCTATGGTA TATTTAATTC GAAAATATTT AAAAGGAATG GACAACATTA CGAGCACAAC GATATAATAG AATTTTTAAA GTAGCCAATA CACAAAAATA TGCTGTGGAA AAAGACACTC ACAAAATCAA CCAAGCTTCA GGTACCTCCT CATATTTGGC ACCGCATAGA AGGAGTGCAC AAAAGAAACG AGCAAAAAAG CACCGTAACC TTTTTTATGC GGTGCTTTGT GGCGCGAGTC TACAAAATAC TGTGTGTGTA TGCGGTTTAC TTGTAGTTGC GGTGGAAAAA ATTTACCTAA ATGTTAATGC CCAAAAGTAT GCACATAGGA GAAGACATAA CAAAAGATTC AAAAGGAGGT ATTTATTTAT TCCTCATAAA TTATAAGCTT TCTTCTAACT TCCATAAAAA TGTATTTACC ACCCAAGATC AAAATAAATG ACCCCACAAA ATATACCAAT CGGCTACAAA TACTTAAAAA AAAAAAAATA GAACGGAAAG AGAAAATTGT TTGTTTTACC TTACGATGTA GCGTTGTCTG TCAGCACTGG GCTGCTGCCC TTTTCCTCTG ATAAACTTTA ACATGATTGG TTATGCTCTT GTGGTGGTTT GGTTTTGATG AATAAATAAG TATATTAATT GTGGCCGAAT TTATTCTAAA CTGAAAATAA TAATAAAAAT TAATCAAATT TTCAATAAGT AAAAAATTAA AAAGGAACTT GTATATTTTT TCACTCTTAT GAATAAAACC GAGAATTTAA ATTTAGGTAA TACTATTAAT ACCTTTTATA GATACGGACG ATACGTTTAA TATTATTCTG GTATACTTTA ATCAAAATTT GTTTAACAAA AAGGGTTTTA CATTCTTGAA GTCATAGG