Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000006
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202304
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200006
Nearest Genes
Gene Nr FlyBase ID Distance
CG2671 FBgn0002121 2449 bp
Sequence Length 2089
ON Targets 0
OFF Targets 0
Viability lethal
Inserted Chromosome 3
Left Primer TGCCCAAAAGTATGCACATAGGAGAAG
Right Primer TCACACTGCCCACAAAATCACGACA
Template genomic
Sequence TGCCCAAAAG TATGCACATA GGAGAAGACA TAACAAAAGA TTGAAAAGGA GGTATTTATT TATTCTTAAT AAATTATAAG CTTTCTTCTA ACTTCCATAA AAATGTATTT ACCACCCAGG ATCAAAATAA ATGACACCCC ACAAAATATA CCAATCGGCT ACATATACGA AAAAAAAAAA ATAAAATAGA ATGGAAAGAG AAAATTGTTT GTTGTACCTT ACGATAAGCA AAAAGGTCCT TCTGTAGGCG GTGTCTGTCA GCACTGGGCT GCTGCCCTTT TCCTCTGATA AACTTTAACA TAATTGGTTA TGCTCTTGTG GTGGGTTGGT TTCGATGAAT AAATATGTAT ACTAATTGTG GCCGTATTTA TTCTAAACTG AAAATAATAA ATAAAAATTA ATCACATTTT CAATAAGTAA AAAATTAAAA AGGAACTTGT ATATTTTTTC ACTCTTATGA ATAAAACCGA GAAATTAAAT TTAGGTAATA CTATTAATAC CTTTTATAGA TACGGACGAT ACGTTTAATA TTATTCTGGT ATACTTTAAT CAAAATTTGT TTAACAAAAA GGGTTTTACA TTCTTGGTCA TAGGAAATTC AGTGGACAGA TAGATCTTGG CTCCCAAGAT TTTCCAAACT AGTTGTGCTT ATTTTCTTAA AACTTCAAAG ATTTGCATGT AGGCAGTTTA ATAAACATGT TTGTACATAT GTATATGTAC ATTAGGAAAA ATGAGATGCA AGATGAGCGA TCTGTACTCT TTGCAATGTG TATGTATGTA CATATGTACC TCCCTTTAAT GAACTAGCAA TTCCGTCACG CACACGAAAT ATTTTTTTAT TTGTAAATCT TTTTTTAAGT TTGTTTAAAC AATTTAGTTA CTATTAAAGC TCTGAAATTC ATAAATAAAT AATAATAAAT GTATTAATTA TGACAAAAAA CAACTTAAAA CATATACGTT TATTTTTGTA AAAGCGTTTT AGGCAAACGC TAGCTGGTCG GTACTAATAT TTTTTCGAAG ACTGTATACC GTATACATAC ATTTATGTAC GTAGGTATGT ATCCGTGAGT AAGCTGAGGT GCAAAACCGT ATCACCATTT GCTTTTCGGC TGATAACCAA TACCAAGTAA GTCAACTGTT TCCCAAATGT ATCTGCATAA CAAGGTGATG ACCTAATTTT GAGTACATAC CGATCTTTAC AGTTGACCAG CTTTGCGATT GCATACCGGT ATCTGTTTAT TCACATATAC ACACACAAAT TGCGTGTTAG ACAGACAGCA AAATGACGAC TGTTAACTGT TGGCGTGGCT GACTCACCGA CTACGCCTCT ATGCTAAGAA CATACATATT TGTGGACACT TTATTTAAGA AGTTTGAAAT ATAAATCAAT TGCCTAATCA GTAATACTGT TGTTGAGCCC TTTACCTTTA TGTATTTCCG TTTGTACGGT TAAGGCGGTG GCCGAGTAAT TTTTTGAACT ATTTTATTTG CTCACCAACA CGCATAAGTT TGTATGTATT CTTATGTTGA GAAACGCCCG CACTGTTCTT CACATCGTTG CTTTAAATGA GAATAAATGA AATAAACGTG TCAACCAAGA ACACACAGAT AATAATACGA CCGGTCAGAG CTTAACCGTG TATCTGTTTT ATAAAACGTG AACAATATTA TTAGCCCAAA ACGATATGCG CGTCATTTTA ACACACACAA AGTCGCGATC GGTGGGTCTA GTGTGCCCGT GTATCTCTAT CGAAAAAATC ATATATTTTT TAGAAGGTAT ATTTTCCATG ACTGACTGGA ATGGGTGGAG AACATCGCTT TGGGAGTGAA ACTCCGCTAT AAATTGTCAT TTGTTTTTAT AGCAACCTTT TTGATATGGT CGCCAACTTT TATATAATTA TAATAATAAT TTTTGTAATT AATCACCGCT GTCGCACGAA AAATTTAGGA AATGTGCCAA CGAGCGGAAT TTTTCGGAAC GATCGATGTT TTACCATAAC CTGCTATATA AATTGTGAAC CACATTTTCA ACACAAAACT AGATGTGCTT CATTTATAAC GCAATGTCGT GATTTTGTGG GCAGTGTGA