Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000005
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202303
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200005
Nearest Genes
Gene Nr FlyBase ID Distance
CG2671 FBgn0002121 3537 bp
Sequence Length 2330
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TGCGACCAGTTCCATACACCCATTC
Right Primer CCGACCAGCTAGCGTTTGCCTAAAA
Template genomic
Sequence TGCGACCAGT TCCATACACC CATTCAAGTA ATTGTACATT AAGCTCCGAT GCTGAATTGT TTAACAAAGT ATGCTGACCG TACAATTCAA CTCCGGGTTG ACCGAAAACT TTTAAAGCCC CTGTTTGCGT CCCTATTGCC ATAAGTTTCA AAACTGGATC ATACGCAAGA GCCGAAGGCT TATGAGGAAA GCCATGCTGT GCCGTCTAAA AGAAAAAAAT ATTAAAAAGT TTCAAAAAGC AATTACAGAT TCTTAATAAT TCAAAATTGT TTGGTTCATT TCTTAATTGT AAAAGGGTTT TCCAAAACAT TCTAGTTTTT TCAGTTCCCA AGATCTGGTA AATCGTCAGA TTACTTGCCA CTTTATAGAG TCGGGAACGC TTTCTTAAAC CATTTACATA CTTTTACCGA ATCTAATACA GCATTTTTCT TTACAATTAA CGGGAATAAA AACCTCAATA AATATTGAGG TTTGAATTTA AATTAAGTTC AAAAAGCGCC CAAAGCTTTA AATGCTGCTC TTAAGTATGT CTCTTATAAA CATCACTGTA GACAGCAGTC CCTACTATCA TACTATATTT ACATTGATCG AAAAAAGGTT TGGTAAATCT TATCTAATTG TATAAATTGT ATTTTTATAC AAAAAAAGTT TTAAGAAGTT GCTATCAGAT CTCGTTATGA GTTGATTTTG TTTGATTCAT ATTGCAGGTG TATTTGGATT TCTAACGCAG TTACAGGCGA ATAAATTCTT TTTCTTTTGA CTTTAAAATC TTATCAATTT TACGCCGTCT ATGACATACT TATTTTGTGC CTGAAATAAG GGTGTTTGTG AAACCAAGCC ATTTACCCAA CCCATTAAGC ACATAAAAGC AATCTTATCA GCTCCCCCCT CTTTCTGGAG CTGGATGGCG ATTACCTCTG ACCTACTTTT ATTTGTTTAA TAACATGTTT ATACTAACAT GGGATAAAAA AAATTCTTAT AAAATTTCAT ATACGTATAT TTATTAAACT ATTATGGTAA TAGGGAAACA TCTATGGTAT ATTTAATTCG AAAATATTTA AAAGGAATGG ACAACATTAC GAGCACAACG ATATAATAGA ATTTTTAAAG TAGCCAAAAA CAGGCGGTGG AAAAAGACAC TCACAAAATC AACAAAGCTT CAGGTACCTC CTCATATTTG GCACCGCATA GAAGGAGTGC ACAAAAGAAA CGAGCAAAAA AGCACCGTAA CCTTTTTTAT GCGGTGCTTT GTGGCGCGAG TCTACAAAAT ACTGTGTGTG TATGCGGTTT ACTTGTAGTT GCGGTGGAAA AAATTTACCT AAATGTTAAT GCCCAAAAGT ATGCACATAG GAGAAGACAT AACAAAAGAT TGAAAAGGAG GTATTTATTT ATTCTTAATA AATTATAAGC TTTCTTCTAA CTTCCATAAA AATGTATTTA CCACCCAGGA TCAAAATAAA TGACACCCCA CAAAATATAC CAATCGGCTA CATATACGAA AAAAAAAAAA TAAAATAGAA TGGAAAGAGA AAATTGTTTG TTGTACCTTA CGATAAGCAA AAAGGTCCTT CTGTAGGCGG TGTCTGTCAG CACTGGGCTG CTGCCCTTTT CCTCTGATAA ACTTTAACAT AATTGGTTAT GCTCTTGTGG TGGGTTGGTT TCGATGAATA AATATGTATA CTAATTGTGG CCGTATTTAT TCTAAACTGA AAATAATAAA TAAAAATTAA TCACATTTTC AATAAGTAAA AAATTAAAAA GGAACTTGTA TATTTTTTCA CTCTTATGAA TAAAACCGAG AAATTAAATT TAGGTAATAC TATTAATACC TTTTATAGAT ACGGACGATA CGTTTAATAT TATTCTGGTA TACTTTAATC AAAATTTGTT TAACAAAAAG GGTTTTACAT TCTTGGTCAT AGGAAATTCA GTGGACAGAT AGATCTTGGC TCCCAAGATT TTCCAAACTA GTTGTGCTTA TTTTCTTAAA ACTTCAAAGA TTTGCATGTA GGCAGTTTAA TAAACATGTT TGTACATATG TATATGTACA TTAGGAAAAA TGAGATGCAA GATGAGCGAT CTGTACTCTT TGCAATGTGT ATGTATGTAC ATATGTACCT CCCTTTAATG AACTAGCAAT TCCGTCACGC ACACGAAATA TTTTTTTATT TGTAAATCTT TTTTTAAGTT TGTTTAAACA ATTTAGTTAC TATTAAAGCT CTGAAATTCA TAAATAAATA ATAATAAATG TATTAATTAT GACAAAAAAC AACTTAAAAC ATATACGTTT ATTTTTGTAA AAGCGTTTTA GGCAAACGCT AGCTGGTCGG